View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_62 (Length: 215)
Name: NF1291_high_62
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 52 - 191
Target Start/End: Original strand, 41593941 - 41594080
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41593941 |
aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
41594040 |
T |
 |
| Q |
152 |
atgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41594041 |
atgttatcacggcccacccacattttgttcatattattgg |
41594080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 52 - 191
Target Start/End: Complemental strand, 12869837 - 12869698
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12869837 |
aacttcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
12869738 |
T |
 |
| Q |
152 |
atgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12869737 |
atgttatcacggcccacccacattttgttcatattattgg |
12869698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 52 - 191
Target Start/End: Original strand, 14006810 - 14006949
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14006810 |
aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcatctcttgttatggcagattggcagtagca |
14006909 |
T |
 |
| Q |
152 |
atgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14006910 |
atgttatcacggcccacccacattttgttcatattattgg |
14006949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 52 - 173
Target Start/End: Complemental strand, 23123989 - 23123876
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
23123989 |
aactacaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcaattgttatgtgattctctgctcttgttatg--------gcagtagca |
23123898 |
T |
 |
| Q |
152 |
atgttatcacggcccacccaca |
173 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23123897 |
atgttatcacggcccacccaca |
23123876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 23123836 - 23123786
Alignment:
| Q |
141 |
tggcagtagcaatgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23123836 |
tggcagtagcaatgttatcacggctcacccacattttgttcatattattgg |
23123786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 52 - 191
Target Start/End: Original strand, 43522545 - 43522684
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43522545 |
aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgctatggcagattggcagtagca |
43522644 |
T |
 |
| Q |
152 |
atgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522645 |
atgttatcacggcccacccacattttgttcatattattgg |
43522684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 52 - 173
Target Start/End: Complemental strand, 22512564 - 22512451
Alignment:
| Q |
52 |
aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca |
151 |
Q |
| |
|
||||| ||| |||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
22512564 |
aactggaatattttcagttttttgtagttatgcacatcttgagcaaccttgcatttgttatgtgattctcttatcttgtta--------tgacagtagca |
22512473 |
T |
 |
| Q |
152 |
atgttatcacggcccacccaca |
173 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
22512472 |
atgttatcacgggccacccaca |
22512451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 22512411 - 22512361
Alignment:
| Q |
141 |
tggcagtagcaatgttatcacggcccacccacattttgttcatattattgg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22512411 |
tggcagtagcaatgttatcacggcccacccacattttgttcatattattgg |
22512361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 32103315 - 32103271
Alignment:
| Q |
64 |
ttcatatttttgttgttatgcacatcttgaggaaccttgcatttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
32103315 |
ttcatatttttgttgttatgcacatcttgagcaaccgttcatttg |
32103271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University