View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_25 (Length: 412)
Name: NF1291_low_25
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 12 - 342
Target Start/End: Original strand, 46193688 - 46194022
Alignment:
| Q |
12 |
agagagaggataatcatgtcatttggaaatagttcgggggacttttaggcatatggaatagtttgtaatctttgctctttccctcaattcggtaatatac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46193688 |
agagagaggataatcatgtcatttggaaatagttcgggggacttttaggcatatggaatagtttgtaatctttgctctttccctcaattcggtaatatac |
46193787 |
T |
 |
| Q |
112 |
cagttggtttctatcagtctcaccgtcacacaaggacgtctttccgaccaatcttgacagatacagttgtcagtccttttccagccttgcccactctttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46193788 |
cagttggtttctatcagtctcaccgtcacacaaggacgtctttccgaccaatcttgacagatacagttgtcagtccttttccagccttgcccactctttc |
46193887 |
T |
 |
| Q |
212 |
tccactagttttattctacagctcctagcagctgtttatccatca----ttatcttctatttcaatctgcttctgttttgacatttgccatgcgttcact |
307 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46193888 |
tccactagttttattctatagctcctagcagctgtttatccatcatggtttatcttctatttcaatctgcttctgttttgacatttgccatgcgttcact |
46193987 |
T |
 |
| Q |
308 |
atgttttggtacagtttctgtattgtgtctgtggt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46193988 |
atgttttggtacagtttctgtattgtgtctgtggt |
46194022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 65 - 127
Target Start/End: Original strand, 46192865 - 46192928
Alignment:
| Q |
65 |
tggaatagtttgtaatctttgctctttccctcaattcggtaat-ataccagttggtttctatca |
127 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
46192865 |
tggaatagtttgtaatctatgttctttccctcaattcagtaataatgccagttggtttctatca |
46192928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University