View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_32 (Length: 360)
Name: NF1291_low_32
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 98 - 262
Target Start/End: Complemental strand, 48183655 - 48183491
Alignment:
| Q |
98 |
ggagggagtatgtgtattaagtttggtcccacaaagtgcaaagcagtactactactgggtcatgcaagaagatataatgaaccacgtaggtacaatatgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48183655 |
ggagggagtatgtgtattaagtttggtcccacaaactgcaaagcagtactactactgggtcatgcaagaagatataatgaaccacgtaggtacaatatgg |
48183556 |
T |
 |
| Q |
198 |
aaacaggaattcattgatttaagagtgaatatgaaagacagaggtttgaaagtcacggtctgtgg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
48183555 |
aaacaggaattcattgatttaagagtgaatatgaaagacaaaggtttgaaagtcacggtttgtgg |
48183491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University