View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_40 (Length: 338)
Name: NF1291_low_40
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 142 - 209
Target Start/End: Original strand, 4649302 - 4649369
Alignment:
| Q |
142 |
ataaaagagaaaattagagtttataatgtatcttcttaaagctttgctatttaatatgacttatgaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4649302 |
ataaaagagaaaattagagtttataatgtatcttcttaaagctttgctatttaatatgacttatgaac |
4649369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 118
Target Start/End: Original strand, 4649246 - 4649279
Alignment:
| Q |
85 |
agatgaaggttgagactaaagataggtccctaat |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
4649246 |
agatgaaggttgagactaaagataagtccctaat |
4649279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 4649428 - 4649461
Alignment:
| Q |
277 |
atatagttcaataggtctaatttatcatggattt |
310 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
4649428 |
atatagttcaataggcctaatttatcatggattt |
4649461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University