View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_41 (Length: 337)
Name: NF1291_low_41
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 85 - 208
Target Start/End: Original strand, 4649246 - 4649369
Alignment:
| Q |
85 |
agatgaaggttgagactaaagataggtccctaatnnnnnnntgcaaannnnnnnnnataaaagagaaaattagagtttataatgtatcttcttaaagctt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4649246 |
agatgaaggttgagactaaagataagtccctaataaaaaaatgcaaatttttttttataaaagagaaaattagagtttataatgtatcttcttaaagctt |
4649345 |
T |
 |
| Q |
185 |
tgctatttaatatgacttatgaac |
208 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4649346 |
tgctatttaatatgacttatgaac |
4649369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 309
Target Start/End: Original strand, 4649428 - 4649461
Alignment:
| Q |
276 |
atatagttcaataggtctaatttatcatggattt |
309 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
4649428 |
atatagttcaataggcctaatttatcatggattt |
4649461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University