View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_46 (Length: 320)
Name: NF1291_low_46
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 58 - 233
Target Start/End: Complemental strand, 42415700 - 42415525
Alignment:
| Q |
58 |
agatgaaatcgacagagattagaagaaaagaggtggatgggtcaggttaatgagccatctattttgacataatctaactaaaagggtttctgagggaaag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42415700 |
agatgaaatcgacagagattagaagaaaagaggtggatgggtcaggttaatgagccatctattttgacataatctaactaaaagggtttctgagggaaag |
42415601 |
T |
 |
| Q |
158 |
tccaaataaatcaatagaacttgcacgcttgtagcctgtgctcacttttaaatagtaaacatctgaatttaaataa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42415600 |
tccaaataaatcaatagaacttgcacgcttgtagcctgtgctcacttttaaatagtaaacatctgaatttaaataa |
42415525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University