View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_56 (Length: 302)
Name: NF1291_low_56
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 57 - 239
Target Start/End: Complemental strand, 50832934 - 50832753
Alignment:
| Q |
57 |
aggagcagagaggaggaagaatcttaaaggttttgtcttgtgatagtaaagcaccaatataaatggaataagtttcaaacaatcaaacaaaagaaaaatt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50832934 |
aggagcagagaggaggaagaatcttaaaggttttgtcttgtgatagtaaagcaccaatataaatggaataagtttcaaacaatcaaacaaaagaaaaatt |
50832835 |
T |
 |
| Q |
157 |
gaaaaacattaagcttcacaaagattatcatgaataaatggttcgtaggttgtctgacagttagaactcacaggaaggtctgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
50832834 |
gaaaaacattaagcttcacaaagattatcatgaataaatggttcgtaagttgtc-gacagttagaactcacaggaaggtctgt |
50832753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University