View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_60 (Length: 296)
Name: NF1291_low_60
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 54 - 247
Target Start/End: Complemental strand, 32830756 - 32830563
Alignment:
| Q |
54 |
agcagagacatgttttgttctattttcagcattggtattagacaaatttggaagaaggcccatgctgttgttgggctcatcaggtatggcagcgtcctta |
153 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32830756 |
agcaaagacatgttttgttctattttcagcattggtattagacagatttggaagaaggcccatgttgttgttgggctcatcaggtatggcagtgtcctta |
32830657 |
T |
 |
| Q |
154 |
tttgggcttggaatgggatgtactttacttcacaattcagatgaaaagcccatgtgggctattgctttgtgtgtggttgctgtctgtggtgctg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
32830656 |
tttgggcttggaatgggatgtactttacttcacaattcagatgaaaagcccatgtgggctattgctttgtgtgtggttgctgtttgtgctgctg |
32830563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University