View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1291_low_62 (Length: 296)

Name: NF1291_low_62
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1291_low_62
NF1291_low_62
[»] chr7 (1 HSPs)
chr7 (1-111)||(7109025-7109135)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 7109025 - 7109135
Alignment:
1 taaatcctctttgatgattagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagc 100  Q
    ||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7109025 taaattctctttgctgcttagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagc 7109124  T
101 tataggcctat 111  Q
    |||||| ||||    
7109125 tataggtctat 7109135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University