View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1291_low_67 (Length: 287)

Name: NF1291_low_67
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1291_low_67
NF1291_low_67
[»] chr7 (1 HSPs)
chr7 (131-270)||(41593941-41594080)
[»] chr8 (1 HSPs)
chr8 (131-270)||(12869698-12869837)
[»] chr5 (3 HSPs)
chr5 (131-270)||(14006810-14006949)
chr5 (131-252)||(23123876-23123989)
chr5 (220-270)||(23123786-23123836)
[»] chr2 (1 HSPs)
chr2 (131-270)||(43522545-43522684)
[»] chr3 (2 HSPs)
chr3 (131-252)||(22512451-22512564)
chr3 (220-270)||(22512361-22512411)
[»] chr4 (1 HSPs)
chr4 (143-187)||(32103271-32103315)


Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 131 - 270
Target Start/End: Original strand, 41593941 - 41594080
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41593941 aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 41594040  T
231 atgttatcacggcccacccacattttgttcatattgttgg 270  Q
    ||||||||||||||||||||||||||||||||||| ||||    
41594041 atgttatcacggcccacccacattttgttcatattattgg 41594080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 131 - 270
Target Start/End: Complemental strand, 12869837 - 12869698
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12869837 aacttcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 12869738  T
231 atgttatcacggcccacccacattttgttcatattgttgg 270  Q
    ||||||||||||||||||||||||||||||||||| ||||    
12869737 atgttatcacggcccacccacattttgttcatattattgg 12869698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 131 - 270
Target Start/End: Original strand, 14006810 - 14006949
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
14006810 aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcatctcttgttatggcagattggcagtagca 14006909  T
231 atgttatcacggcccacccacattttgttcatattgttgg 270  Q
    ||||||||||||||||||||||||||||||||||| ||||    
14006910 atgttatcacggcccacccacattttgttcatattattgg 14006949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 131 - 252
Target Start/End: Complemental strand, 23123989 - 23123876
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||        |||||||||    
23123989 aactacaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcaattgttatgtgattctctgctcttgttatg--------gcagtagca 23123898  T
231 atgttatcacggcccacccaca 252  Q
    ||||||||||||||||||||||    
23123897 atgttatcacggcccacccaca 23123876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 23123836 - 23123786
Alignment:
220 tggcagtagcaatgttatcacggcccacccacattttgttcatattgttgg 270  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| ||||    
23123836 tggcagtagcaatgttatcacggctcacccacattttgttcatattattgg 23123786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 131 - 270
Target Start/End: Original strand, 43522545 - 43522684
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43522545 aactgcaatgttttcatatttttgttgttatgcacatcttgagcaaccttgcatttgttatgtgattctcttctcttgctatggcagattggcagtagca 43522644  T
231 atgttatcacggcccacccacattttgttcatattgttgg 270  Q
    ||||||||||||||||||||||||||||||||||| ||||    
43522645 atgttatcacggcccacccacattttgttcatattattgg 43522684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 131 - 252
Target Start/End: Complemental strand, 22512564 - 22512451
Alignment:
131 aactgcaatgttttcatatttttgttgttatgcacatcttgaggaaccttgcatttgttatgtgattctcttctcttgttatggcagattggcagtagca 230  Q
    ||||| ||| ||||||  ||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||        || ||||||||    
22512564 aactggaatattttcagttttttgtagttatgcacatcttgagcaaccttgcatttgttatgtgattctcttatcttgtta--------tgacagtagca 22512473  T
231 atgttatcacggcccacccaca 252  Q
    |||||||||||| |||||||||    
22512472 atgttatcacgggccacccaca 22512451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 22512411 - 22512361
Alignment:
220 tggcagtagcaatgttatcacggcccacccacattttgttcatattgttgg 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
22512411 tggcagtagcaatgttatcacggcccacccacattttgttcatattattgg 22512361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 187
Target Start/End: Complemental strand, 32103315 - 32103271
Alignment:
143 ttcatatttttgttgttatgcacatcttgaggaaccttgcatttg 187  Q
    ||||||||||||||||||||||||||||||| |||| | ||||||    
32103315 ttcatatttttgttgttatgcacatcttgagcaaccgttcatttg 32103271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University