View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_low_80 (Length: 255)
Name: NF1291_low_80
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_low_80 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 4177646 - 4177539
Alignment:
| Q |
1 |
cttctctctatgtatatacatatatttgtgacttgcactcttttttatgaaattgtgcataatttatactatatatataaagggatactatcttttatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4177646 |
cttctctctatgtatatacatatatttgtgacttgcactcttttttatgaaattgtgcataatttatactatatatataaagggatactatcctttatgt |
4177547 |
T |
 |
| Q |
101 |
aacattat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
4177546 |
aacattat |
4177539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 4078411 - 4078511
Alignment:
| Q |
5 |
tctctatgtatatacatatatttgtgacttgcactcttttttatgaaattgtgcataatttatactatatatataaagggatactatcttttatgtaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
4078411 |
tctctatgtatatacatatatttgtgacttgcactc--ttttatgaaattgtgcataatttatac-atatatataaagggatactatgttttatgtaaca |
4078507 |
T |
 |
| Q |
105 |
ttat |
108 |
Q |
| |
|
|||| |
|
|
| T |
4078508 |
ttat |
4078511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 136 - 202
Target Start/End: Complemental strand, 4177517 - 4177451
Alignment:
| Q |
136 |
catcctttagtgcaaataaatttatcacttactttcaaatacgttcaaataaaactagttagtaata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4177517 |
catcctttagtgcaaataaatttatcacttactttcaaatactttcaaataaaactagttagtaata |
4177451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 136 - 209
Target Start/End: Original strand, 4078533 - 4078606
Alignment:
| Q |
136 |
catcctttagtgcaaataaatttatcacttactttcaaatacgttcaaataaaactagttagtaatacaacaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
4078533 |
catcctttagtgcaaataaatttatcacttactttcaactacgttcaaataaaactagttagcaatagaacaaa |
4078606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University