View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292-Insertion-3 (Length: 184)
Name: NF1292-Insertion-3
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292-Insertion-3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 11082623 - 11082800
Alignment:
| Q |
8 |
atgattgcatgagtagcaagaaaatcatacattccttgctcatctgtgtcatcattgatcactgcattcccaatctgtgcatataataatataacaaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11082623 |
atgattgcatgagtagcaagaaaatcatacattccttgctcatctgtgtcatcattgatcactgcattcccaatctgtgcatataataatataacaaaat |
11082722 |
T |
 |
| Q |
108 |
gtaaacatattcatctttgttacattaaattgttccattcccata-nnnnnnnataatttttatgttctattcatcca |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
11082723 |
gtaaacatattcatctttgttacattaaattgttccattcacatattttttttataatttttatgttctattcatcca |
11082800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University