View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12920_high_19 (Length: 252)
Name: NF12920_high_19
Description: NF12920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12920_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 49685238 - 49685402
Alignment:
| Q |
1 |
caatgcccatatctcagcagttacagaattgttgcggccaagattgcagtaaaaatcttggatgaaatctccacgaaatctcttagtaatcctccacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49685238 |
caatgcccatatctcagcagttacagaattgttgcggccaagattgcagtaaaaatcttggatgaaagctccacgaaatctcttagtaatcctccacaag |
49685337 |
T |
|
| Q |
101 |
gcgattgaacattgactttattatgagatccatcagcattaaatttataagtaccttcaattaga |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49685338 |
gcgattgaacattgactttattatgagatccatcagcattaaatttataagtaccttcaattaga |
49685402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 49685430 - 49685478
Alignment:
| Q |
165 |
actattttcttccatgtatcttgaaggtttaaccataattggagaatca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
49685430 |
actattttcttccatgtatcttgaaggtttaaccatatttggacaatca |
49685478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University