View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12920_low_11 (Length: 369)
Name: NF12920_low_11
Description: NF12920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12920_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 40741742 - 40742004
Alignment:
| Q |
1 |
tgtcgacttcaaatgttttctctgatatggaaacatgtcacgtctccaaactaggaataccttttcatggatactctttagtggaaggtcttaagttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40741742 |
tgtcgacttcaaatgttttctctgatatggaaacatgtcacgtctccaaactaggaataccttttcatgaatactctttagtggaaggtcttaagttttc |
40741841 |
T |
 |
| Q |
101 |
atggaaaataaatttattaggaaaatgtcatacccgtgttgctctgtcagcttcccaaaggaccacctgtggtatgaaaattggtatatctgcaagtgaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741842 |
atggaaaataaatttattagggaaatgtcatacccgtgatgct-------cttcccaaaggaccacctgtggtatgaaaattggtatatctgcaagtgaa |
40741934 |
T |
 |
| Q |
201 |
aaatagtgtgcagggatagaatgacaggcctctaactagattattgtgaaaaataaatctttaggaataa |
270 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741935 |
aaatagtgtgcagggataaaatgacaggcctctaactagattattgtgaaaaataaatctttaggaataa |
40742004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University