View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12920_low_19 (Length: 281)
Name: NF12920_low_19
Description: NF12920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12920_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 49684974 - 49684698
Alignment:
| Q |
1 |
ttaaccgaaaatgaaccgccaaataaccaacaagtactagcaattcaacagcttgaacttgttcagtaatgcgttgtttttcttttcttattaagaaagt |
100 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49684974 |
ttaaccgaaaaagaaccgccaaataatcaacaagtactagcaattcaacggcttgaacttgttcagtaatgcattgtttttcttttcttattaagaaagt |
49684875 |
T |
 |
| Q |
101 |
gcaaaactatgtatatcgtttttcatcttttaaaactaattccagtagtttcagtttctgatcaaattaagttaaagccaaaaccctaaagctattatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684874 |
gcaaaactatgtatatcgtttttcatcttttaaaactaattccagtagtttcagtttctgatcaaattaagttaaagccaaaaccctaaagctattatca |
49684775 |
T |
 |
| Q |
201 |
tcaccaacagcaccactgctgaacatagagctaccctttacctc---ttctcctctagggacgactttcctttgcta |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49684774 |
tcaccaacagcaccactgctgaacatagagctaccctttacctcttcttctcctctagggacgactttcctttgcta |
49684698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University