View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12922_low_8 (Length: 331)
Name: NF12922_low_8
Description: NF12922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12922_low_8 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 185 - 316
Target Start/End: Complemental strand, 46551026 - 46550895
Alignment:
| Q |
185 |
cccatcgttagaccaaatctccattagacgcctctgaattatgaataagtaacttaattctaaacaattttgtttcaaatttaggggtttatatttgcca |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46551026 |
cccatcgttagaccaaatctccattagacgcctctgaattatgaataagtaacttaattctaaacaattttgtttcaaatttaggggtttatatttgcca |
46550927 |
T |
 |
| Q |
285 |
agcaggaactaggaggagattttatttcaaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46550926 |
agcaggaactaggaggagattttatttcaaac |
46550895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 46551210 - 46551141
Alignment:
| Q |
1 |
ttttcttaaagcaaaaatgcggttcgtggaattttcgggaaaatgattgtcgctggatttagcattgcac |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46551210 |
ttttcttaaagcaaaaatgcggttcgtggaatttttgggaaaatgattgtcgctggatttagcattgcac |
46551141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4940955 - 4940888
Alignment:
| Q |
1 |
ttttcttaaagcaaaaatgcggttcgtggaattttcgggaaaatgattgtcgctggatttagcattgc |
68 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
4940955 |
ttttcttaaagtaaaaatacggttcgtggaattctcgggaaaacaattgccgctggatttagcattgc |
4940888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 24122805 - 24122859
Alignment:
| Q |
14 |
aaaatgcggttcgtggaattttcgggaaaatgattgtcgctggatttagcattgc |
68 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
24122805 |
aaaatgcggttcgtggaatttttgggaaaataattgtcgctagatttagcattgc |
24122859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 40872621 - 40872671
Alignment:
| Q |
14 |
aaaatgcggttcgtggaattttcgggaaaatgattgtcgctggatttagca |
64 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40872621 |
aaaatgcacttcgtggaattttcgggaaaagaattgtcgctggatttagca |
40872671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 64
Target Start/End: Complemental strand, 93661 - 93611
Alignment:
| Q |
14 |
aaaatgcggttcgtggaattttcgggaaaatgattgtcgctggatttagca |
64 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
93661 |
aaaatgcacttcgtggaattttcgggaaaagaattgtcgctggatttagca |
93611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University