View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12924_high_21 (Length: 286)
Name: NF12924_high_21
Description: NF12924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12924_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 5430350 - 5430629
Alignment:
| Q |
1 |
aagctttaacaaaaagctcgaatttgagacaccctattaagcaaatcgaagacatgacacatgatattggccggtcgttgggagttttgcttgttgcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5430350 |
aagctttaacaaaaagctcgaatttgagacaccctattaagcaaatcgaggacatgacacatgatattggccggtcgttgggagttttgcttgttgcaag |
5430449 |
T |
 |
| Q |
101 |
ccttgaagtgtctattgattttagagaaaagattggtacattgcaaagacagatgatgaatgcaagatttgacggcagttcaagtatgacttcaagtccg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5430450 |
ccttgaagtatctattgattttagagaaaagattggtacattgcaaagacagatgatgaatgcaagatttgacggcagttcaagtatgacttcaagtccg |
5430549 |
T |
 |
| Q |
201 |
aaatcagaatttttcatgagtgaaacgaggacggttggtgaaatagaagaggaaatcgttcatgtttctattgatgatgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5430550 |
aaatcagaatttttcatgagtgaaacgaggatggttggtgaaatagaagaggaaatcgttcatgtttctattgatgatgt |
5430629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University