View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12924_high_30 (Length: 244)
Name: NF12924_high_30
Description: NF12924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12924_high_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 14167031 - 14167258
Alignment:
| Q |
1 |
gcttcagtttgcgccaattttggattgatctcgtcaccaacatacctaaatgcagtcactagccctaccaaaagctgctcaaaaaatcaaccacaaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14167031 |
gcttcagtttgcgccaattttggattgatctcatcaccaacatacctaaatgcagtcactagccctaccaaaagctgctcaaaaaatcaaccacaaaatc |
14167130 |
T |
|
| Q |
101 |
aagaaaccgtgatttcaagaaatatcacattatgttaaattcctaattttcatatatgtaattgaaatcaatcttttgtccgcgatcatgatctaatatt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14167131 |
aagaaaccatgatttcaagaaatatcacattatgttaaattcctaattttcatatatgtaattgaaatcaatcttttgtccgcgatcatgatctaatatt |
14167230 |
T |
|
| Q |
201 |
gcatattgttaagagttaatggaaaaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14167231 |
gcatattgttaagagttaatggaaaaag |
14167258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 84
Target Start/End: Complemental strand, 5180852 - 5180772
Alignment:
| Q |
4 |
tcagtttgcgccaattttggattgatctcgtcaccaacatacctaaatgcagtcactagccctaccaaaagctgctcaaaa |
84 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || || |||||||||||| |||| | || |||||||||||||||||| |
|
|
| T |
5180852 |
tcagtttgtgccaattttgcattgatctcatctccctcatacctaaatgagctcaccaatccaaccaaaagctgctcaaaa |
5180772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University