View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12924_low_26 (Length: 265)
Name: NF12924_low_26
Description: NF12924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12924_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 21271699 - 21271423
Alignment:
| Q |
1 |
caaaggacagagagaagaaacttgcaggaataatgagtacaccaacaaacaa------------atgcacaacacaagacacctaataaggacacgcaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
21271699 |
caaaggacagagagaagaaacttgcaggaataatgagtacaccaacaaacaacaccttggttgaattcacaacacaagacacctaataaggacacgcaaa |
21271600 |
T |
|
| Q |
89 |
aaccaagttatttttctgtcactctctaaaacatccttatacaaatcatttatttatttatgggaacattgtcagaaatttcgttcctcaaattgaagaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21271599 |
aaccaagttatttttctgtcactctctaaaacatccttatacaaatcatttatttatttataggaacattgtcagaaatttcgttcctcaatttgaagaa |
21271500 |
T |
|
| Q |
189 |
taatgtgggggaagagagattccattttcatatcatatcttcacttacattactcacaattcataatcaaaatattc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21271499 |
taatgtgggggaagagagattccattttcatatcatatcatcacttacattactcacaattcataatcaaaatattc |
21271423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University