View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12924_low_41 (Length: 217)
Name: NF12924_low_41
Description: NF12924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12924_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 202
Target Start/End: Original strand, 48267096 - 48267274
Alignment:
| Q |
22 |
acactatggtctagctatgct---tctctcttttattttatctcaactgaaccgaaccaaccaagacattaattaattaccttcatttaatttgaaagct |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48267096 |
acactatggtctagctatgctgcttctctcttttattttatctcaactgaac-----caaccaagacattaattaattaccttcatttaatttgaaagct |
48267190 |
T |
 |
| Q |
119 |
atcaaaaagcaacctcaagtgtcagttttggcgtgcatatcttaacaacgtggtatgtattgttaactgtgtgtgtcttgtttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48267191 |
atcaaaaagcaacctcaagtgtcagttttggcgtgcatatcttaacaacgtggtatgtattgttaactgtgtgtgtcttgtttt |
48267274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University