View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12926_high_10 (Length: 251)
Name: NF12926_high_10
Description: NF12926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12926_high_10 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 15996869 - 15996636
Alignment:
| Q |
18 |
atggggcaatcagcagtagagaaacagaaaacgctgaacaatcacaagtattgcaacacgtctgcctgttatattttggtggcagtgccatagcacctag |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
15996869 |
atggggcaatcagcacaagagaaacagaaagcgctgaacaatcacaagtattgcagtacatctgcctgtcatattttgatggtagtgccatagcacctac |
15996770 |
T |
|
| Q |
118 |
actcgattgtttcagcggtctcatacaagccatcaagagcaacacatgcagctgcattattattaaaggcatagatgattcttatcttggcttaaagatt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996769 |
actcgattgtttcagcggtctcacacaagccatcaagagcaacacatgcagctgcattattattaaaggcatagatgattcttatcttggcttaaagatt |
15996670 |
T |
|
| Q |
218 |
aacatggcatgtgcttttggtacggacattgttc |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
15996669 |
aacattgcatgtgcttttggtacggacattgttc |
15996636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 161
Target Start/End: Original strand, 15613999 - 15614061
Alignment:
| Q |
99 |
gcagtgccatagcacctagactcgattgtttcagcggtctcatacaagccatcaagagcaaca |
161 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||| |||||| |||||| ||||| |
|
|
| T |
15613999 |
gcagtgccgtagcacctagaccaaattgttgcagcggtctcatgcaagccgtcaagaacaaca |
15614061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University