View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12926_high_11 (Length: 251)
Name: NF12926_high_11
Description: NF12926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12926_high_11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 22123736 - 22123971
Alignment:
| Q |
16 |
gttcatactcttaggaatgagttcatgtctatggcttttgattactggtcagaccctaatatggagattgctacttacatccattctgccatggttgatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22123736 |
gttcatactcttaggaatgagttcatgtctatggcttttgattactggtcagaccctaacatggagattgctacttacatccattctgccatggttgatg |
22123835 |
T |
|
| Q |
116 |
gaatagtaacagattttccagccactacaaatagatatctcagtaagaaattcaatctcttcagttcaactgaatatttcaaaaagtttatgatttaact |
215 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | | ||||||||||||||||||| |
|
|
| T |
22123836 |
gagtagtcacagattttccagccactacaaatagatatctcagtaagaaattcaatctcttcagttcaactgattagtacgaaaagtttatgatttaact |
22123935 |
T |
|
| Q |
216 |
cataatgaatgaaacagaagatgatgagtgaatcgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22123936 |
cataatgaatgaaacagaagatgatgagtgaatcgc |
22123971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University