View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12926_high_12 (Length: 250)
Name: NF12926_high_12
Description: NF12926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12926_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 3 - 234
Target Start/End: Complemental strand, 15996092 - 15995861
Alignment:
| Q |
3 |
aacaacaacagattgcattgctgtaggcctgatccaggagtattaaagtgtaatgttgatgcaagttttcatcggtctataaacatgacaagtaatggct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996092 |
aacaacaacagattgcattgctgtaggcctgatccaggagtattaaagtgtaatgttgatgcaagttttcatcggtctataaacatgacaagtaatggct |
15995993 |
T |
 |
| Q |
103 |
gttgtatccgcggcactaccaggacggtttagtccgaagctatctgttcatggtgagcccacgggactatgtaatgctatgaattgggtccttagtttgg |
202 |
Q |
| |
|
| |||||||| |||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15995992 |
gctgtatccgtggcactgccaggacagtttaatccgaagctatctgttcatggtgagcccacgggactatgtaatgctatgaattgggtccttagtttgg |
15995893 |
T |
 |
| Q |
203 |
gatataacaacattttctttgattgtgactca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15995892 |
gatataacaacattttctttgattgtgactca |
15995861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University