View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12926_low_10 (Length: 255)
Name: NF12926_low_10
Description: NF12926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12926_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 8 - 214
Target Start/End: Original strand, 43995053 - 43995254
Alignment:
| Q |
8 |
agaaatgaaaaagaagaagagttgatacctggtcaagaagccattaatggaagtgaaagtgttgttgtagtattaaagaaggagagatctgagtgtgacg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43995053 |
agaaatgaaaaagaagaagagttgatacctggtcaagaagccattaatggaagtgaaagtgttgttgtagtattaaagaaggagagatctgagtgtgacg |
43995152 |
T |
 |
| Q |
108 |
tgtgtacgttttcttcttcactgcgttttgttttgttttcttctgtatatcttaacagagagagaaagagctaacactaaacagtactagtagagagata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43995153 |
tgtgtacgttttcttcttcactgcgttttgttttatt-----ctgtatatctgaacagagagagaaagatctaacactaaacagtactagtagagagata |
43995247 |
T |
 |
| Q |
208 |
gatagcg |
214 |
Q |
| |
|
||||||| |
|
|
| T |
43995248 |
gatagcg |
43995254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University