View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12926_low_14 (Length: 218)
Name: NF12926_low_14
Description: NF12926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12926_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 6326450 - 6326263
Alignment:
| Q |
18 |
atatctagccaaagatttcatgacattcgattattaaatggaatgggcaatattaaatatgtatatgtaaacatgtgcatacctttgtcagagttttttc |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326450 |
atatctagccaacgatttcatgacattcgattattaaatggaatgggcaatattaaatatgtatatgtaaacatgtgcatacctttgtcagagttttttc |
6326351 |
T |
 |
| Q |
118 |
ttttgtcacacaatgtaaataagtaatattttgaaacttttggtattaaaatttatttttagttaactaacatgtgattttggtctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326350 |
ttttgtcacacaatgtaaataagtaatattttgaaacttttggtattaaaatttatttttagttaactaacatgtgattttggtctct |
6326263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University