View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12927_low_5 (Length: 248)
Name: NF12927_low_5
Description: NF12927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12927_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 37 - 229
Target Start/End: Original strand, 50465525 - 50465724
Alignment:
| Q |
37 |
taatagatttgatgtagcaaaacagagaggagaaaatggggtaagaaaatcaagattacaattgaaaatgttgtatagagttagtacttgatcgtgctag |
136 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465525 |
taatagatttgatgtagcaaaatagagaggagaaaatggggtaagaaaatcaagattacaattgaaaatgttgtatagagttagtacttgatcgtgctag |
50465624 |
T |
|
| Q |
137 |
ttgacttgtttgtgaatggctaaaaagaat-------tagtaatacacagttgcatatccattcttttatgtacatgcataatgcattacattctgtgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465625 |
ttgacttgtttgtgaatggctaaaaagaattagtaagtagtaatacacagttgcatatccattcttttatgtacatgcataatgcattacattctgtgat |
50465724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University