View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12928_high_23 (Length: 236)

Name: NF12928_high_23
Description: NF12928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12928_high_23
NF12928_high_23
[»] chr8 (1 HSPs)
chr8 (24-220)||(40179203-40179399)


Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 24 - 220
Target Start/End: Original strand, 40179203 - 40179399
Alignment:
24 tggtttcatcattgtgtcagcaacatggtgtcaaaagaggagctgttcagtgcaggaaaaggtggggaaatcttctgactgatttcaggaagatcaagaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40179203 tggtttcatcattgtgtcagcaacatggtgtcaaaagaggagctgttcagtgcaggaaaaggtggggaaatcttctgactgatttcaggaagatcaagaa 40179302  T
124 atgggagtcaaatataaaggatgagtctgagtctttttggataatgagaaatgatgtgaggaaagaaaacaaattgcctggtttctttgattctgtg 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40179303 atgggagtcaaatataaaggatgagtctgagtctttttggataatgagaaatgatgtgaggaaagaaaacaaattgcctggtttctttgattctgtg 40179399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University