View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12928_high_26 (Length: 218)
Name: NF12928_high_26
Description: NF12928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12928_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 3544736 - 3544921
Alignment:
| Q |
20 |
cggacaagggctaataagacaggaagaagaaattgaagacttgaagtgttatgtgatgaggtttcaccctggatcattgcagaggtgtgctaaattgaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544736 |
cggacaagggctaataagacaggaagaagaaattgaagacttgaagtgttatgttatgaggtttcaccctggatcattgcagaggtgtgctaaattgaga |
3544835 |
T |
 |
| Q |
120 |
tctaaagaggctgtgaatttggttaggagttatagttctgctctttttaatagtgaagggtttgattcagttgacagtgatgatgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544836 |
tctaaagaggctgtgaatttggttaggagttatagttctgctctttttaatagtgaagggtttgattcagttgacagtgatgatgt |
3544921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University