View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12928_low_20 (Length: 294)
Name: NF12928_low_20
Description: NF12928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12928_low_20 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 240 - 294
Target Start/End: Original strand, 31805245 - 31805299
Alignment:
| Q |
240 |
tagataatagtgttattttagagcagtgtttaattatttgttgcttgtatattct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31805245 |
tagataatagtgttattttagagcagtgtttaattatttgttgcttgtattttct |
31805299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 31804992 - 31805030
Alignment:
| Q |
1 |
aatatcatgtatgctcttttatgagaatgtgcattattt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31804992 |
aatatcatgtatgctcttttatgagaatgtgcattattt |
31805030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University