View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12928_low_25 (Length: 238)
Name: NF12928_low_25
Description: NF12928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12928_low_25 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 6066423 - 6066203
Alignment:
| Q |
18 |
gaaattgatgaattggccctacttggataatagtagagttcacaatgttgatgttttgttataattaagcttattgtattttgatggaatgacatgcaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6066423 |
gaaattgatgaattggccctacttggataatagtagagttcacaatgttgatgttttgttataattaagcttattgtattttgatggaatgacatgcaca |
6066324 |
T |
|
| Q |
118 |
tcatgaatatgtggcttatttttgaataaaactttttggttttaaggggaaagggtttgttaatataaagttcttccgggaaataaatatagaccgataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
6066323 |
tcatgaatatgtggcttatttttgaataaaactttttggttttaaggggaaagggtttgttaatataaatttcttccgggaaataaatatagtccgataa |
6066224 |
T |
|
| Q |
218 |
agaattgttccaaccaagatt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6066223 |
agaattgttccaaccaagatt |
6066203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University