View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12928_low_27 (Length: 234)
Name: NF12928_low_27
Description: NF12928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12928_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 24 - 214
Target Start/End: Original strand, 40179203 - 40179393
Alignment:
| Q |
24 |
tggtttcatcattgtgtcagcaacatggtgtcaaaagaggagctgttcagtgcaggaaaaggtggggaaatcttctgactgatttcaggaagatcaagaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40179203 |
tggtttcatcattgtgtcagcaacatggtgtcaaaagaggagctgttcagtgcaggaaaaggtggggaaatcttctgactgatttcaggaagatcaagaa |
40179302 |
T |
|
| Q |
124 |
atgggagtcaaatataaaggatgagtctgagtctttttggataatgagaaatgatgtgaggaaagaaaacaaattgcctggtttctttgat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40179303 |
atgggagtcaaatataaaggatgagtctgagtctttttggataatgagaaatgatgtgaggaaagaaaacaaattgcctggtttctttgat |
40179393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University