View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_25 (Length: 387)
Name: NF12929_high_25
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 19 - 379
Target Start/End: Original strand, 45549449 - 45549809
Alignment:
| Q |
19 |
aagggttatatattttagttcgtgaaagacatatcatgtaactgttagatttatattatgtaatttatgttcatatgacataaattggcggttttagatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549449 |
aagggttatatattttagttcgtgaaagacatatcatgtaactgttagatttatattatgtaatttatgttcatatgacataaattggcggttttagatc |
45549548 |
T |
 |
| Q |
119 |
ctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagcattgtacaacgtagaagtaggaagcagttcatgttctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549549 |
ctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagaattgtacaacgtagaagtaggaagcagttcatgttctgt |
45549648 |
T |
 |
| Q |
219 |
gaatatgctaaaccttttttggtctgctccatttaagacattcaattttccagatgctctaccactagcttcttgttcatttcttctactcaacatttgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549649 |
gaatatgctaaaccttttttggtctgctccatttaagacattcaattttccagatgctctaccactagcttcttgttcatttcttctactcaacatttgt |
45549748 |
T |
 |
| Q |
319 |
tcaatcttttcaggctttattttcttgctgtccatgaatttatgatcttttagtgtctgtg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45549749 |
tcaatcttttcaggctttattttcttgctgtccatgaatttatgatcttttagtgtttgtg |
45549809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University