View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_3 (Length: 842)
Name: NF12929_high_3
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_3 |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 523; Significance: 0; HSPs: 175)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 523; E-Value: 0
Query Start/End: Original strand, 163 - 841
Target Start/End: Complemental strand, 47143387 - 47142719
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaactaatgctattttcgtgtgcatgtcaattgtttcatgtatcaatt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
47143387 |
taaattgatccattggtgtaagggtacttcgtttaagaattctcgaggtttgaaactaatgctattttcgtgtacatgt--------------atcaatt |
47143302 |
T |
 |
| Q |
263 |
ccatgtctctttaattcgatttgatgcttactcagtttcgattcgattatagtgatgcaaattcgattttgtttatgtttactcaatttatttcggtttt |
362 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47143301 |
ctatgtctctttaattcgatttgatgcttactcagtttcgattcgattatt-tgatgcaaattcgattttgtttatgtttactcaatttatttcgatttt |
47143203 |
T |
 |
| Q |
363 |
gcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataaattgatataggttatggcgcttagcatataacatttattgaac |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47143202 |
gcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatagaaattgatataggttatggcgcttagcatataacatttattgaac |
47143103 |
T |
 |
| Q |
463 |
tctgttatgatattgattgtgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaacta |
562 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47143102 |
tctgttatgatattaattgtgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaacta |
47143003 |
T |
 |
| Q |
563 |
attatcgcttatttagttagttttataatctatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgttgttg--- |
659 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47143002 |
attatcgcttgtttagttagttttataatcaatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaacaaacgttgttgttg |
47142903 |
T |
 |
| Q |
660 |
--cnnnnnnnnnnaactgaatctctcttaatttgcaaattgttctgtgaggcaaacagaatccgccccaatttatatttttgaattcgtagtttctgttc |
757 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47142902 |
tttttttttttttaactgaatctctcttaatttgcaaattgttctgcgaggcaaacagaaaccgccccaatttatatttttgaattcgtagtttctgttc |
47142803 |
T |
 |
| Q |
758 |
ttgttttaaaatacttatttttgatcgcgtacgacaacgatcaaaacttaaagaagtgtgcacaccctatattattcatctcac |
841 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47142802 |
ttgttttcaaatacttatttttgatcgcgtacgacaacgatcaaaacttaaagaagtgtgcacaccctatattattcatctcac |
47142719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 382 - 654
Target Start/End: Complemental strand, 20070575 - 20070315
Alignment:
| Q |
382 |
agttgctttatcacttgtttaaatcagtttgaatataaattgatataggttatggcgcttagcatataacatttattgaactctgttatgatattgattg |
481 |
Q |
| |
|
|||| ||||||| ||||| ||||| |||||||||| |||||||||||||||||| |||||||||||||| ||| |||||| | ||||||||||| | || |
|
|
| T |
20070575 |
agtttctttatcgcttgtataaattagtttgaatagaaattgatataggttatgacgcttagcatataagattgattgaattttgttatgatataaactg |
20070476 |
T |
 |
| Q |
482 |
tgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaactaattatcgcttatttagtta |
581 |
Q |
| |
|
|||| || ||| ||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
20070475 |
tgttatcta------------actttcatggttagttgaacacattctgatgcttaatcgaatggaatttgtataaaactaattattgctcgtttagtta |
20070388 |
T |
 |
| Q |
582 |
gttttataatctatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgt |
654 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| | |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
20070387 |
gttttataatcaatcaggccttagacatgtgaatcaatgtttatcaagaactcatgatagaaagaataaacgt |
20070315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 35665875 - 35665933
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35665875 |
taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt |
35665933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 39832904 - 39832962
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
39832962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 5234205 - 5234148
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
5234148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 6509471 - 6509414
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
6509414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 17999726 - 17999665
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
17999726 |
taataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
17999665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 44344790 - 44344733
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
44344733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 44568700 - 44568635
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| | |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44568700 |
attatttaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
19561394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
35210459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 1614556 - 1614614
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1614556 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 26878082 - 26878016
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26878082 |
aattatttataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35838339 - 35838281
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35838281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 12894403 - 12894346
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
12894346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 13769769 - 13769826
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
13769769 |
taattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 19757747 - 19757804
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
19757804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 25988383 - 25988440
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 27458398 - 27458455
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
27458455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 28911907 - 28911850
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28911850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 44958507 - 44958450
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt |
44958450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 1974009 - 1974065
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
1974065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 6108333 - 6108389
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 8144294 - 8144350
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 19783811 - 19783867
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
19783811 |
aataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 23399977 - 23399921
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 25092159 - 25092215
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25547434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 26877677 - 26877733
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 28911573 - 28911633
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
28911573 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
28911633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 33 - 85
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
37372493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 44509055 - 44508999
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 46829312 - 46829256
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt |
46829256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 24 - 84
Target Start/End: Complemental strand, 48192493 - 48192433
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
48192493 |
taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 9659351 - 9659410
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
9659351 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 25547248 - 25547303
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
25547248 |
taataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
17854205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 20388272 - 20388330
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
20388272 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20388330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 23676455 - 23676397
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23676455 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 23816668 - 23816726
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
23816668 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgt |
23816726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 29198300 - 29198358
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29198300 |
ataggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 35015223 - 35015165
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
35015223 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 85
Target Start/End: Complemental strand, 37372917 - 37372848
Alignment:
| Q |
15 |
atcaattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| || ||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
37372917 |
atcaattatcaa-aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt |
37372848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 39719644 - 39719586
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
39719644 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt |
39719586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 43300606 - 43300664
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||| ||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
43300606 |
ttaatatgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 46759656 - 46759710
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 1614905 - 1614848
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1614848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 2945846 - 2945789
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt |
2945789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 3975548 - 3975605
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3975605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 6509207 - 6509264
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt |
6509264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 8144660 - 8144603
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 8555800 - 8555743
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
8555743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 9659690 - 9659633
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
9659633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 21554758 - 21554697
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| || |||||| ||||||||||||| |
|
|
| T |
21554758 |
taataggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgt |
21554697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 23399610 - 23399667
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 23676130 - 23676187
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 29198664 - 29198607
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 30709646 - 30709593
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 35837923 - 35837976
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 39520397 - 39520454
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgt |
39520454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45073642 - 45073585
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45073585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45228919 - 45228862
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
45228862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 46828943 - 46829000
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
46829000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 48854071 - 48854014
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgt |
48854014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 5308323 - 5308379
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
5308379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 10357997 - 10358057
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| | ||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10357997 |
aataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt |
10358057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 10358368 - 10358312
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
10358312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 16853589 - 16853533
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16853533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt |
17999521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 25988750 - 25988694
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 30223460 - 30223516
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 35469880 - 35469936
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgt |
35469936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 39439030 - 39438974
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 39719353 - 39719409
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgt |
39719409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 39833236 - 39833180
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
39833180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
46304328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 46759942 - 46759886
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt |
46759886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 6079810 - 6079865
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
6079865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 18022707 - 18022652
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18022707 |
ataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 19465983 - 19465925
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
19465983 |
ataggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgt |
19465925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 21223749 - 21223694
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt |
37527366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 3975840 - 3975786
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 5354766 - 5354824
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
5354824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 22539928 - 22539986
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||| ||||||||||||| ||||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 31310363 - 31310421
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgt |
31310421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
32189334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35104297 - 35104239
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| |||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
35104239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 35210180 - 35210238
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35210180 |
taggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35470282 - 35470224
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||| |||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
35470282 |
taggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgt |
35470224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 41054238 - 41054180
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
41054238 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
41054180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 45021860 - 45021806
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |
|
|
| T |
45021860 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 45073312 - 45073370
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| | ||||||||||||||| ||||||| |
|
|
| T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgt |
45073370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 489073 - 489016
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| || || |||||||||||||||||| ||||||||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt |
489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 1559706 - 1559649
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt |
1559649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 12932788 - 12932727
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
12932788 |
taataggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
12932727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 13770082 - 13770025
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | ||||||||||||||| ||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt |
13770025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 14543709 - 14543762
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 31503780 - 31503727
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgt |
31503727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 44402959 - 44403016
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | | ||||||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgt |
44403016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 44841359 - 44841412
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt |
44841412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 5233807 - 5233863
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 14739005 - 14738949
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 25092549 - 25092493
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 28262709 - 28262769
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||| ||||||||||| ||||||| |
|
|
| T |
28262709 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgt |
28262769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 31732101 - 31732157
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| ||||| ||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
31732157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 35104077 - 35104133
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 44568325 - 44568381
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgtttt-ggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 77
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 45671211 - 45671270
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||| ||| | ||||||||||||||||| |||||||| ||||| |
|
|
| T |
45671211 |
ataggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt |
45671270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 3807862 - 3807920
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| | ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgt |
3807920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 6892262 - 6892204
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||| ||||||| |||||||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt |
6892204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 11767277 - 11767219
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgt |
11767219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| | |||||| ||||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt |
28263015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 37952671 - 37952725
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgt |
37952725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 43058752 - 43058806
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgt |
43058806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 83
Target Start/End: Complemental strand, 45671552 - 45671494
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||| ||||||||||||||| || | ||||||||||||||||| |||||||||||| |
|
|
| T |
45671552 |
aataggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 1559342 - 1559399
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||||||||| ||||| ||||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 5308687 - 5308631
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgt |
5308631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 16940761 - 16940818
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgt |
16940818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16940996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 23817035 - 23816978
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||| ||||| ||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt |
23816978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 30223796 - 30223743
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 38486792 - 38486739
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| | |||||||||||||||| |
|
|
| T |
38486792 |
taggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 39438739 - 39438792
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 39520727 - 39520674
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||| ||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgt |
39520674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 41053841 - 41053898
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgt |
41053898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 46304085 - 46304138
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| | ||| |||||||| ||||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 48852443 - 48852496
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 33 - 85
Target Start/End: Original strand, 6954862 - 6954914
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgt |
6954914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 7432249 - 7432201
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||| |||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 21223405 - 21223461
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgt |
21223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 28528905 - 28528961
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgt |
28528961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 85
Target Start/End: Complemental strand, 1271590 - 1271543
Alignment:
| Q |
38 |
atggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1271543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 80
Target Start/End: Complemental strand, 5355121 - 5355066
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||| |||| ||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
5355121 |
aataggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 6847122 - 6847063
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
6847122 |
atagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgt |
6847063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 18926884 - 18926943
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||||||||||||| | | | |||||||| ||||||||||||| ||||||||| |
|
|
| T |
18926884 |
atagactaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgt |
18926943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||||||| |||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 20355406 - 20355461
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||| |||| |||| | |||||||| |||||||||||| ||||||| |
|
|
| T |
20355406 |
taggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttt |
75 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 18311938 - 18311888
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagtcc |
18311888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttag |
78 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 45228612 - 45228670
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
45228612 |
ataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 81
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 6911081 - 6911134
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||| ||| || ||||||||||||||||| ||||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 31503423 - 31503476
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgt |
31503476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 36684534 - 36684583
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||| ||| |||| | ||||||| |||||||||||||||| |
|
|
| T |
36684534 |
aggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 38186369 - 38186422
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||| |||||| |||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgt |
38186422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 38186762 - 38186709
Alignment:
| Q |
28 |
aggctaaaatatggttttaa-tccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| | || |||||||| ||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||| ||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 430; Significance: 0; HSPs: 194)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 163 - 841
Target Start/End: Complemental strand, 29682846 - 29682178
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaactaatgctattttcgtgtgcatgtcaattgtttcatgtatcaatt |
262 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
29682846 |
taaattgatccattggtgtaaggttacttcgtttatgaattctcgaggtttgaaactaatgctaatttcgtgtacatgtcaattgtttcatgtatcaatt |
29682747 |
T |
 |
| Q |
263 |
ccatgtctctttaattcgatttgatgcttactcagtttcgattcgattatagtgatgcaaattcgattttg-tttatgtttactcaatttatttcggttt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||| ||| |||||| ||||||||| ||||||||||||| ||| |
|
|
| T |
29682746 |
tcatgtctctttaattcgatttgatgcttactcaatttcgattcgattctattgatgcaatttcaattttgttttatgtttcctcaatttatttccattt |
29682647 |
T |
 |
| Q |
362 |
tgcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataaattgatataggttatggcgcttagcatataacatttattgaa |
461 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29682646 |
tgcaccattgagattattcaagtagctttttcacctgtttaaatcagtttgaatagaaattgatataggttatggcgcttatcatataacatttattgaa |
29682547 |
T |
 |
| Q |
462 |
ctctgttatgatattgattgtgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaact |
561 |
Q |
| |
|
| |||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
29682546 |
ttttgttatgatattaattgtgtt----------------cactgtcatggttaattgaacacattgtgatgattaatcgaatgaaatttgtataaaact |
29682463 |
T |
 |
| Q |
562 |
aattatcgcttatttagttagttttataatctatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgttgttgc- |
660 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29682462 |
aattatcacttgtttagttagttttataatcaatcagaccttataattgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgttgttgct |
29682363 |
T |
 |
| Q |
661 |
----nnnnnnnnnnaactgaatctctcttaatttgcaaattgttctgtgaggcaaacagaatccgccccaatttatatttttgaattcgtagtttctgtt |
756 |
Q |
| |
|
|| ||||||||| |||||||| |||||||| ||||||||||||| || | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29682362 |
ttttttttttttttaattgaatctcttttaatttgaaaattgttttgtgaggcaaacaaaaacagccccaatttatatttttgaattcgtagtttctgtt |
29682263 |
T |
 |
| Q |
757 |
cttgttttaaaatacttatttttgatcgcgtacgacaacgatcaaaacttaaagaagtgtgcacaccctatattattcatctcac |
841 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29682262 |
cttgttttaaaatacttatttttgatcgcgtacgacaacgatcaaaacttaaagaagtgtgcacaccctatattattcatctcac |
29682178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 167; E-Value: 5e-89
Query Start/End: Original strand, 320 - 654
Target Start/End: Complemental strand, 25424850 - 25424517
Alignment:
| Q |
320 |
caaattcgattttgtttatgtttactcaatttatttcggttttgcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataa |
419 |
Q |
| |
|
||||||||||| | || ||| ||||| |||| ||||||||||||||||||||||||||| | |||||||||| ||||| ||||||| |||||||| || |
|
|
| T |
25424850 |
caaattcgattctattgatgcttact-aattagtttcggttttgcaccattgagattatttgatttgctttatcgcttgtataaatcattttgaatagaa |
25424752 |
T |
 |
| Q |
420 |
attgatataggttatggcgcttagcatataacatttattgaactctgttatgatattgattgtgttcactgtgacgcttgtccactgtcatggttaattg |
519 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||| || |||||| ||||||| | ||||||| ||||||||||| |||| | ||||||| ||| |
|
|
| T |
25424751 |
attgatataggttatgacgcttagcatataagattgattaaattctgttttgatattaactgtgttctaagtgacgcttgttcactttgatggttagttg |
25424652 |
T |
 |
| Q |
520 |
aacacattctgatgattaatagaatggaatttgtataaaactaattatcgcttatttagttagttttataatctatcagaccttagacatgtgagtgaat |
619 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||| ||||||| |||||||||||| |||||||||| |||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
25424651 |
aacaaattctgatgcttaatcgaatggaatttatataaaattaattatcgcttgtttagttagtcttataatcaatcaggccttagacatgtgaatgaat |
25424552 |
T |
 |
| Q |
620 |
gcttatcaagaacccatgatagaaagaataaacgt |
654 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
25424551 |
gtttagcaagaacccatgatagaaagaataaacgt |
25424517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 163 - 510
Target Start/End: Original strand, 25242070 - 25242403
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaa-ctaatgctattttcgtgtgcatgtcaattgtttcatgtatcaat |
261 |
Q |
| |
|
|||||||||||||| ||||||| || |||| |||||||||||| |||||||| | |||||| | |||||| | ||| ||||||| || ||| ||||| |
|
|
| T |
25242070 |
taaattgatccattcgtgtaagagtgcttcatttatgaattcttgaggtttggattctaatgtgaatttcgtttacatttcaattgctttctgtctcaat |
25242169 |
T |
 |
| Q |
262 |
tccatgtctctttaattcgatttgatgcttactcagtttcgattcgattatagtgatgcaaattcgattttgtttatgtttactcaatttatttcggttt |
361 |
Q |
| |
|
| ||||||||| |||||||| ||| |||| | ||| || |||| |||||||||||||| |||| ||| ||||||||||| |||| |||| |
|
|
| T |
25242170 |
t-------tctttaatttgatttgatacttgctcaatctcgtctctatta-----atgcaaattcgattatgttgatgcttactcaatttgtttcagttt |
25242257 |
T |
 |
| Q |
362 |
tgcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataaattgatataggttatggcgcttagcatataacatttattgaa |
461 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
25242258 |
tgcaccaatgagattattcaaattgctttatcacttgtttaaattagtttgaatataaattgatataggttatgtggcttagcatataa---tgattgaa |
25242354 |
T |
 |
| Q |
462 |
ctctgttatgatattgattgtgttcactgtgacgcttgtccactgtcat |
510 |
Q |
| |
|
| ||| |||||||| ||||||||| |||||| ||||| |||| |||| |
|
|
| T |
25242355 |
ttatgtaatgatattaattgtgttctatgtgacacttgttcactttcat |
25242403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 163 - 306
Target Start/End: Complemental strand, 25424983 - 25424839
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaa-ctaatgctattttcgtgtgcatgtcaattgtttcatgtatcaat |
261 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||| || ||||| | ||||||||| |||||| | |||||||||||||| | ||||||| |
|
|
| T |
25424983 |
taaattgatccattggtgtaagggtgctccgtttatgaattcttgatgtttggatgctaatgctaatttcgtttacatgtcaattgttttctatatcaat |
25424884 |
T |
 |
| Q |
262 |
tccatgtctctttaattcgatttgatgcttactcagtttcgattc |
306 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25424883 |
ttcatatctctttaattcgatttgatgcttactcaaattcgattc |
25424839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 21391094 - 21391152
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 990389 - 990324
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
990389 |
attattattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 3679625 - 3679682
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
3679682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 6567497 - 6567440
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
6567440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 13260323 - 13260266
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 14007488 - 14007545
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14007545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 39747840 - 39747779
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39747840 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
39747779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 990087 - 990143
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 24 - 84
Target Start/End: Original strand, 18473267 - 18473327
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18473267 |
taataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 19622653 - 19622709
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 19623018 - 19622962
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 41881092 - 41881148
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 45290456 - 45290512
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 13770486 - 13770545
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13770486 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13770545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 22919681 - 22919740
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
22919681 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
22919740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 29688429 - 29688374
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 34808194 - 34808253
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34808194 |
ataggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt |
34808253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 41358667 - 41358608
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
41358667 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 8140432 - 8140490
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8140490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 11822367 - 11822309
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt |
11822309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 48609596 - 48609538
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgt |
48609538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 1810926 - 1810983
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 3247197 - 3247254
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
3247254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 12360969 - 12360912
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
12360912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 18302388 - 18302331
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
18302331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 19720711 - 19720768
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
19720768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 29072496 - 29072553
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29072553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 32626528 - 32626585
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
32626585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 34002941 - 34002884
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt |
34002884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 45368489 - 45368546
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45368546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 45380270 - 45380327
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 48609235 - 48609292
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt |
48609292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 52254182 - 52254235
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 3753209 - 3753269
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3753209 |
aataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3753269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 10631164 - 10631220
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10631220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 10887600 - 10887544
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 15526363 - 15526307
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 20948755 - 20948811
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt |
20948811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 671 - 762
Target Start/End: Complemental strand, 25424480 - 25424391
Alignment:
| Q |
671 |
aactgaatctctcttaatttgcaaattgttctgtgaggcaaacagaatccgccccaatttatatttttgaattcgtagtttctgttcttgtt |
762 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||||||| || | |||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
25424480 |
aactgaatctctcttaaattgcaaattgttccgtgaagcaaacaaaaac--ccccaatttatacttttgaattcgtagctgatgttcttgtt |
25424391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 26061955 - 26062011
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 30322928 - 30322984
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 31061152 - 31061096
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 32729050 - 32728994
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 33000670 - 33000614
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 35308111 - 35308055
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
35308055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
2939985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 18473596 - 18473541
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 21383101 - 21383160
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
21383101 |
ataggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
21383160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
27521632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 33379887 - 33379942
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt |
39303730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 47819228 - 47819287
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
47819228 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 4789310 - 4789364
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4789364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 7819105 - 7819047
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgt |
7819047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 7867127 - 7867185
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
7867185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 13259986 - 13260044
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt |
13260044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 32454296 - 32454238
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
32454296 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt |
32454238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 35005746 - 35005692
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 38164306 - 38164240
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38164306 |
aattcttaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 50429211 - 50429153
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50429153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 50799128 - 50799186
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
50799186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 3753573 - 3753516
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 10887231 - 10887288
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 11822003 - 11822056
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 12361010 - 12361067
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt |
12361067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 18899842 - 18899895
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18899895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
18900077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttag |
78 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 24507844 - 24507787
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24507787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 26442900 - 26442843
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt |
26442843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 31060777 - 31060842
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| | ||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
31060777 |
attattatttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 33045691 - 33045634
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
33045634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 35307714 - 35307771
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
35307771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 45290822 - 45290765
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 10631529 - 10631473
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 12322970 - 12322914
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
12322914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 24654168 - 24654112
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 29072862 - 29072806
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt |
29072806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 31258338 - 31258394
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 35005443 - 35005499
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 38151212 - 38151156
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
38151156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 42482975 - 42483035
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
42482975 |
aataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgt |
42483035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 44641432 - 44641376
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44641376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 47819597 - 47819541
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 48956066 - 48956010
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
48956010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 52254479 - 52254423
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
52254423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 16026942 - 16026883
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
16026942 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 26324582 - 26324641
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26324582 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
26324641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 44157696 - 44157751
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
44157751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 4565342 - 4565280
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
4565342 |
ttaataggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt |
4565280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| || ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt |
17129745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 24649662 - 24649604
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
24649662 |
taggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24649604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
26207334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 33067346 - 33067400
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||||||||||||||| |||| |
|
|
| T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 35056897 - 35056839
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35056897 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 45638896 - 45638846
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 3247564 - 3247507
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 4360627 - 4360570
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgt |
4360570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 7867358 - 7867301
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt |
7867301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 8364619 - 8364672
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgt |
8364672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 12360594 - 12360659
Alignment:
| Q |
20 |
ttattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| |
|
|
| T |
12360594 |
ttattaataggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgt |
12360659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 15211510 - 15211567
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgt |
15211567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 15516580 - 15516637
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 17984332 - 17984389
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 26191354 - 26191411
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
26191354 |
taattggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 30323295 - 30323238
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 31404724 - 31404667
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
31404724 |
taggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 33234545 - 33234602
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
33234602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 50428872 - 50428929
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||| ||||| ||||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgt |
50428929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 8140800 - 8140744
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 12322604 - 12322656
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 16060885 - 16060829
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16060829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 25658014 - 25658070
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgt |
25658070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 26324951 - 26324891
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||| | |||||||| |||||||||||||||||| |||| |
|
|
| T |
26324951 |
aataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgt |
26324891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 28507462 - 28507402
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
28507462 |
aataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgt |
28507402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 33000305 - 33000361
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
33000361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 41739122 - 41739067
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgt |
41739067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 4323829 - 4323884
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||| |||||||| |||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgt |
4323884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 36912848 - 36912895
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttg |
71 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
36912848 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 44158043 - 44157988
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 49073690 - 49073745
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 15334915 - 15334965
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
15334915 |
taggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 77
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 21383430 - 21383372
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
21383430 |
taggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt |
21383372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 22674200 - 22674254
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
22674200 |
ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 22919979 - 22919925
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| || || |||||||| |||||||| |||||||||| |
|
|
| T |
22919979 |
taggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 81
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
35 |
aatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 33045353 - 33045411
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt |
33045411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| ||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt |
45368793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 8364918 - 8364861
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 15335292 - 15335239
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgt |
15335239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 16060595 - 16060651
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgt |
16060651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 18302072 - 18302109
Alignment:
| Q |
48 |
tccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18302072 |
tccctgcaaatatgtctcgttttggttttagtccctgt |
18302109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 20756022 - 20756071
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtcc |
20756071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 33380257 - 33380204
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccc-tacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 37624745 - 37624798
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| |||||||||||||| |||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 26062255 - 26062203
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 33234912 - 33234856
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgt |
33234856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 39747473 - 39747528
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 41738796 - 41738852
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| |||| |||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt |
41738852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 71
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttg |
71 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 19198948 - 19198893
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgt |
19198893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 757 - 800
Target Start/End: Complemental strand, 25424322 - 25424279
Alignment:
| Q |
757 |
cttgttttaaaatacttatttttgatcgcgtacgacaacgatca |
800 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
25424322 |
cttgttttaaaatacttatttttgatcgtgcacgacaatgatca |
25424279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 84
Target Start/End: Original strand, 30962404 - 30962471
Alignment:
| Q |
17 |
caattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| || |||||||||||||||| || ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30962404 |
caattttttataggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||| |||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 37625026 - 37624971
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||| ||||| |||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgt |
37624971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 4617397 - 4617339
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| | || |||||||||| ||||||||||||||||| |||| |
|
|
| T |
4617397 |
taggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctgt |
4617339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 25658299 - 25658245
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgt |
25658245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 26142418 - 26142476
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||| || | |||||||| |||||||||||||||||| |||| |
|
|
| T |
26142418 |
taggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgt |
26142476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 55 - 85
Target Start/End: Original strand, 32453956 - 32453986
Alignment:
| Q |
55 |
aaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctgt |
32453986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 83
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
38 |
atggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 4617083 - 4617144
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||| ||||||| ||||||||| |||| |
|
|
| T |
4617083 |
taataggttaaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgt |
4617144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 5058989 - 5058936
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgt |
5058936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 18079397 - 18079454
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||| ||| | |||||||| ||| ||||||||||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt |
18079454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 21391371 - 21391318
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||||||| ||||||||| |||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttg |
71 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 70
Target Start/End: Complemental strand, 32035792 - 32035747
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgtttt |
70 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
32035792 |
aataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 174)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 163 - 654
Target Start/End: Complemental strand, 22805854 - 22805366
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaa-ctaatgctattttcgtgtgcatgtcaattgtttcatgtatcaat |
261 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||| |||||||| | ||||||||| ||| || | |||||||||| || | ||||||| |
|
|
| T |
22805854 |
taaattgatccattggtgtaagggtgctccgtttatgaattcttgaggtttggattctaatgctaattttgtttacatgtcaatttctttctatatcaat |
22805755 |
T |
 |
| Q |
262 |
tccatgtctctttaattcgatttgatgcttactcagtttcgattcgattatagtgatgcaaattcgattttgtttatgtttactcaatttatttcggttt |
361 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||| ||||| || |||||||||||||||| || ||| |||| | || | ||||||||| |
|
|
| T |
22805754 |
ttcatgtctctttaattcgatttgatgcttactcaattttgattc-----tattgatgcaaattcgattagattgatgcttacacgatctgtttcggttt |
22805660 |
T |
 |
| Q |
362 |
tgcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataaa-ttgatataggttatggcgcttagcatataacatttattga |
460 |
Q |
| |
|
||||||||||||| |||| ||||| |||||| |||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
22805659 |
tgcaccattgagagtatttgagttgttttatcgcttgtttaaatcagtttgaatagaaatttgatataggttatggcacttagcatataagattgattga |
22805560 |
T |
 |
| Q |
461 |
actctgttatgatattgattgtgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaac |
560 |
Q |
| |
|
| |||||||||||||| | ||||||| ||||||||||| |||| ||||||||| ||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
22805559 |
attctgttatgatattaactgtgttctaagtgacgcttgttcactctcatggttagttgaacacattctgatgcttaatcgaatggaatttgtataaaat |
22805460 |
T |
 |
| Q |
561 |
taattatcgcttatttagttagttttataatctatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgt |
654 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||| ||||| | || ||||| ||| ||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
22805459 |
taattaccgcttgtttacttagttttataatcaatcaggcttttgacatctgaatgaatctttatcaagaacccgtgatagaaggaataaacgt |
22805366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 44985986 - 44985928
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44985986 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
44985928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 11788420 - 11788360
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11788420 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11788360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 16523335 - 16523269
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16523335 |
attattaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 8046328 - 8046385
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
8046385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 17541777 - 17541724
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 33575750 - 33575807
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 41451831 - 41451892
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41451831 |
ttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 8046648 - 8046592
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
8046592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 10671945 - 10671889
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
10671945 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 11713485 - 11713541
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11713541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 19183781 - 19183837
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36622306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 13215053 - 13215116
Alignment:
| Q |
22 |
attaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13215053 |
attactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13215116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 40302342 - 40302283
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40302342 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
40302283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 44559059 - 44559118
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44559059 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
44559118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 1138361 - 1138303
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgt |
1138303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 40786458 - 40786516
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt |
40786516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 44994067 - 44994005
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
44994067 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgt |
44994005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 4424186 - 4424129
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4424129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 20131315 - 20131372
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 24483892 - 24483835
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
24483835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25705084 - 25705141
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25705141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 26239162 - 26239105
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 33732861 - 33732918
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33732918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 38639410 - 38639463
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 41693673 - 41693730
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
41693730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 9195054 - 9195110
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
9195110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 10375069 - 10375013
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgt |
10375013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 16900207 - 16900151
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 16993598 - 16993542
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 19184152 - 19184096
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 24358946 - 24358890
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 26707869 - 26707929
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26707869 |
aataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgt |
26707929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 26814230 - 26814174
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 33576118 - 33576062
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 37271738 - 37271794
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 37272103 - 37272047
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 38980254 - 38980198
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 43788854 - 43788910
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43788854 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 20939324 - 20939269
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
20939269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 9195208 - 9195150
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt |
9195150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 10664982 - 10665040
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt |
10665040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 10671628 - 10671686
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgt |
10671686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 43592044 - 43592102
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
43592102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 43597152 - 43597210
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
43597210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 44985623 - 44985677
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44985677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 2265398 - 2265341
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt |
2265341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 2481558 - 2481501
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2481501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 3837932 - 3837989
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt |
3837989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 4042609 - 4042662
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 4423894 - 4423951
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
4423951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 11713846 - 11713789
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11713789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 16522990 - 16523047
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 16968555 - 16968608
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt |
16968608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 17302144 - 17302087
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
17302087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 20658411 - 20658362
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
20658411 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 22881612 - 22881665
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 24358614 - 24358671
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 25705451 - 25705394
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 26238816 - 26238869
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
26238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 29859873 - 29859816
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
29859816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 31644840 - 31644897
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
31644897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 32476094 - 32476151
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgt |
32476151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 38731828 - 38731885
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38731885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 42358702 - 42358755
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
42358755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 43597500 - 43597443
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
43597443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 146690 - 146634
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
146634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 3838268 - 3838208
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3838268 |
aataagctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
3838208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 13850518 - 13850578
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
13850518 |
aataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt |
13850578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 14003743 - 14003687
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 15842824 - 15842768
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 16673410 - 16673466
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 17541381 - 17541437
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 20658059 - 20658147
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgtnnnnnnnntttgtttttagtccctgcaaaa |
115 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||||| || |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaattgtttttagtccctgcaaaa |
20658147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 27311071 - 27311015
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 31226077 - 31226021
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgt |
31226021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 33 - 85
Target Start/End: Complemental strand, 36806892 - 36806840
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
36806840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 41694003 - 41693947
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
41693947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 44073808 - 44073752
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 85
Target Start/End: Complemental strand, 4794468 - 4794417
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgt |
4794417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10374830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29865277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 29865514 - 29865455
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
29865514 |
ataggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt |
29865455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 30215874 - 30215815
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
30215874 |
ataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgt |
30215815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 3671001 - 3671059
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||| ||||||||||||| |
|
|
| T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 7814739 - 7814681
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
7814739 |
taggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 15842450 - 15842516
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| || |||| |||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15842450 |
aattaatattaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 81
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
35 |
aatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 44559407 - 44559353
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
44559353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 1295544 - 1295491
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt |
1295491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 14003407 - 14003464
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 16673773 - 16673716
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 17912447 - 17912500
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||| ||||||||| ||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 18113088 - 18113145
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgt |
18113145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 18113463 - 18113398
Alignment:
| Q |
20 |
ttattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
18113463 |
ttataaattggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgt |
18113398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 674 - 759
Target Start/End: Complemental strand, 22805325 - 22805241
Alignment:
| Q |
674 |
tgaatctctcttaatttgcaaattgttctgtgaggcaaacagaatccgccccaatttatatttttgaattcgtagtttctgttctt |
759 |
Q |
| |
|
||||| |||| |||||||||| |||||| |||| ||||||| || || ||||||||||||||||||||||| ||| | |||||||| |
|
|
| T |
22805325 |
tgaatttctcctaatttgcaagttgttccgtgaagcaaacaaaaccc-ccccaatttatatttttgaattcatagctgctgttctt |
22805241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 23989836 - 23989889
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 25954114 - 25954167
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 27310875 - 27310931
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgt |
27310931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 34964164 - 34964103
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
34964164 |
taattggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgt |
34964103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 36815836 - 36815779
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgt |
36815779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 37228732 - 37228789
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgt |
37228789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40301974 - 40302031
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||| |||||||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgt |
40302031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 45442697 - 45442644
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 1497610 - 1497666
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||| ||||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
1497666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 2481192 - 2481248
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| | | | ||||||||||||||||||||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 7814245 - 7814301
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 12835325 - 12835381
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
12835381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 30215421 - 30215477
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 32691309 - 32691369
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
32691309 |
aataggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgt |
32691369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 34317798 - 34317854
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
34317854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatat-gtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 43789193 - 43789137
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 24483401 - 24483456
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24483456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 29831813 - 29831860
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttt |
75 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
29831813 |
aggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 36815485 - 36815544
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||||||||||||| |
|
|
| T |
36815485 |
ataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgt |
36815544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 43710384 - 43710435
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt |
1138037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 3832640 - 3832586
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
3832640 |
ataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 37910754 - 37910812
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| ||| |||| |||||||||||||| |
|
|
| T |
37910754 |
taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgt |
37910812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
41791074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 13215367 - 13215318
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 22881949 - 22881912
Alignment:
| Q |
48 |
tccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22881949 |
tccctgcaaatatgtctcgttttggttttagtccctgt |
22881912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 25954423 - 25954370
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||| | |||||||| ||||||||| ||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
25954370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||| ||||| | ||| |||||||||||||||||||| |||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 31225714 - 31225771
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||||||||| ||||||| ||||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgt |
31225771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 31326253 - 31326196
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||| | |||||||| |||||||| |||||||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgt |
31326196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 35155620 - 35155563
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt |
35155563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 37911121 - 37911064
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgt |
37911064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 43672319 - 43672262
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgt |
43672262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 43710709 - 43710652
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt |
43710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| || || |||||||||||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||| | ||| |||||||| |||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 31325920 - 31325976
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| || ||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt |
31325976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 40124966 - 40125022
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||| ||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgt |
40125022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 41791312 - 41791256
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||| |||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgt |
41791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 31909480 - 31909423
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgt |
31909423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 70
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgtttt |
70 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 35686342 - 35686288
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||| |||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
35686342 |
aataggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 38732143 - 38732077
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| |||| |||||| || ||||| |||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
38732143 |
attattattaggttaaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgt |
38732077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 44993806 - 44993859
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| || ||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctgt |
44993859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 3172019 - 3172072
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 3172533 - 3172480
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||| ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 10665295 - 10665238
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| || || |||||||| |||||||||||||||| ||||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgt |
10665238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 14393129 - 14393077
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||| | | ||| |||||||||||||||||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 19831511 - 19831564
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| || | ||||||||| |||||||||||||||| ||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
19831564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 23732329 - 23732273
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| || || |||||||| |||||||||| |||||||||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgt |
23732273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 33576076 - 33576031
Alignment:
| Q |
39 |
tggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 40125290 - 40125233
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| ||| |||| |||||||||||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgt |
40125233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 43592381 - 43592328
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||||| | |||||||||| ||||| ||||||||| |
|
|
| T |
43592381 |
aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc |
43592328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 43671933 - 43671990
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
43671933 |
aggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgt |
43671990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 210; Significance: 1e-114; HSPs: 170)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-114
Query Start/End: Original strand, 163 - 654
Target Start/End: Original strand, 24031233 - 24031723
Alignment:
| Q |
163 |
taaattgatccattggtgtaagggtacttcgtttatgaattctcgaggtttgaaa-ctaatgctattttcgtgtgcatgtcaattgtttcatgtatcaat |
261 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||| |||||||| | ||||||||| ||| | | ||||||||||| | ||||||| |
|
|
| T |
24031233 |
taaattgatccattggtgtaagggtgctttgtttatgaattcttgaggtttggattctaatgctaattttttttacatgtcaattgctgtcgatatcaat |
24031332 |
T |
 |
| Q |
262 |
tccatgtctctttaattcgatttgatgcttactcagtttcgattcgattatagtgatgcaaattcgattttgtttatgtttactcaatttatttcggttt |
361 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||| ||||||||| || |||||||||||| ||| | || ||| ||||||||| | ||||||||| |
|
|
| T |
24031333 |
ttcatgtctctttaattcgatttgatgcctactcaatttcgattc-----tattgatgcaaattcaattatattgatgcttactcaatctgtttcggttt |
24031427 |
T |
 |
| Q |
362 |
tgcaccattgagattattcaagttgctttatcacttgtttaaatcagtttgaatataaattgatataggttatggcgcttagcatataacatttattgaa |
461 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||||| |||||||||||||||| ||||||||||| |||||||||||| ||||||| ||| |||||| |
|
|
| T |
24031428 |
tgcaccattgagattatttgagttgttttattgcttgtataaatcagtttgaatagaaattgatataccttatggcgcttatcatataagattgattgaa |
24031527 |
T |
 |
| Q |
462 |
ctctg---ttatgatattgattgtgttcactgtgacgcttgtccactgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaa |
558 |
Q |
| |
|
|||| |||||||||| | ||||||| ||||||||||| |||| ||||||||| ||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
24031528 |
ttctgttattatgatattaactgtgttctaagtgacgcttgttcactctcatggttagttgaacacattctgatgcttaatcgaatggaatttgtataaa |
24031627 |
T |
 |
| Q |
559 |
actaattatcgcttatttagttagttttataatctatcagaccttagacatgtgagtgaatgcttatcaagaacccatgatagaaagaataaacgt |
654 |
Q |
| |
|
| ||||||| |||| |||| |||||||||||||| ||||| |||| ||||||||| ||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
24031628 |
attaattatggcttgtttacttagttttataatcaatcaggcctttgacatgtgaatgaatctttatcaagaacccatgatagaaggaataaacgt |
24031723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 14238740 - 14238807
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14238740 |
aattaataaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 29158351 - 29158410
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29158351 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
29158410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 20984511 - 20984454
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
20984454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 19494115 - 19494174
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
19494115 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 25600219 - 25600286
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
25600219 |
aatttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt |
25600286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 35097324 - 35097383
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35097324 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 35347002 - 35346943
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35347002 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 1526175 - 1526117
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1526175 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 1778557 - 1778619
Alignment:
| Q |
22 |
attaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1778557 |
attaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 8094476 - 8094534
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
8094476 |
ataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 10337117 - 10337175
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10337175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 35115650 - 35115584
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35115650 |
aattaataataggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 40492958 - 40493016
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt |
40493016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 3512268 - 3512211
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3512268 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 4474045 - 4473988
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
4473988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 7272419 - 7272476
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
7272476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 8298976 - 8298919
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8298919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 10872914 - 10872971
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
10872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 14239081 - 14239024
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 16789074 - 16789131
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
16789131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 18549578 - 18549517
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18549578 |
taatagactaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt |
18549517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 22650463 - 22650520
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
22650520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 24187568 - 24187625
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt |
24187625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25131110 - 25131167
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
25131167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 27341592 - 27341535
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27341535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 28324182 - 28324125
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt |
28324125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 34963674 - 34963609
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| | ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34963674 |
attattatttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 43477162 - 43477219
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
43477219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 7186004 - 7185948
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
7185948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 7420229 - 7420285
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 8298587 - 8298643
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8298643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 11019519 - 11019575
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 14489073 - 14489017
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
14489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 16644045 - 16643989
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 16789369 - 16789313
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16789313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 22917563 - 22917619
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 24187898 - 24187842
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 24955012 - 24954956
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 29158669 - 29158617
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 32725906 - 32725962
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 42133154 - 42133098
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
42133098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 17073804 - 17073863
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
17073804 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17073863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 17574466 - 17574407
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
17574466 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17574407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 28258244 - 28258189
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
28258244 |
ataggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 35143848 - 35143789
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
35143848 |
aataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 13779151 - 13779205
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgt |
13779205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 27117751 - 27117809
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt |
27117809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 33526414 - 33526356
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 29 - 115
Target Start/End: Complemental strand, 40066820 - 40066734
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgtnnnnnnnntttgtttttagtccctgcaaaa |
115 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| | ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaaaaaaaatttgtttttggtccctgcaaaa |
40066734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 3511904 - 3511961
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 4473702 - 4473759
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 4710222 - 4710165
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 9496339 - 9496396
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 11019859 - 11019802
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 11976372 - 11976429
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
11976429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 11976738 - 11976681
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 13232201 - 13232254
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13232254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 14495068 - 14495125
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
14495125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 82
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 16643659 - 16643716
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
16643659 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 20984145 - 20984202
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt |
20984202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28346760 - 28346703
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 29488111 - 29488054
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
29488054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 32418317 - 32418370
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 32726273 - 32726216
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 33636318 - 33636375
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33636318 |
aataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 40844532 - 40844479
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt |
40844479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 1525808 - 1525860
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 2728231 - 2728287
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 4017301 - 4017245
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 4375692 - 4375748
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
4375748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 7272751 - 7272695
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgt |
7272695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 7326421 - 7326365
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
7326365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 10776499 - 10776443
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10776443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 28346393 - 28346449
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 28399039 - 28398979
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28399039 |
aataggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt |
28398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 34963299 - 34963355
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 37536085 - 37536141
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 38930301 - 38930357
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 40844156 - 40844212
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
40844212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
6146893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 82
Target Start/End: Complemental strand, 8094843 - 8094788
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| |||||||||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 13154883 - 13154942
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
13154883 |
ataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgt |
13154942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 15930933 - 15930988
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgt |
15930988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 18549198 - 18549257
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
18549198 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgt |
18549257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 19962992 - 19963051
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||| ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
19962992 |
ataggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt |
19963051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt |
30969454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 83
Target Start/End: Original strand, 5357419 - 5357477
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5357419 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 6469270 - 6469336
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
6469270 |
attattattaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgt |
6469336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 7326083 - 7326141
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
7326083 |
ataggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 13155253 - 13155195
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgt |
13155195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 32040073 - 32040131
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| | ||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
32040073 |
taggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt |
32040131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35345619 - 35345561
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgt |
35345561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 7420591 - 7420534
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgt |
7420534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 9175011 - 9175068
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgt |
9175068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 10337451 - 10337394
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 10540783 - 10540726
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
10540726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 13796593 - 13796540
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgt |
13796540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 20277691 - 20277748
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
20277748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 21064318 - 21064375
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
21064375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 21125718 - 21125775
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
21125775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 674 - 762
Target Start/End: Original strand, 24031764 - 24031850
Alignment:
| Q |
674 |
tgaatctctcttaatttgcaaattgttctgtgaggcaaacagaatccgccccaatttatatttttgaattcgtagtttctgttcttgtt |
762 |
Q |
| |
|
||||| |||| |||||||||| |||||| |||| ||||||| || || |||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
24031764 |
tgaatttctcctaatttgcaagttgttccgtgaagcaaacaaaaccc--cccaatttatatttttgaattcatagctgctgttcttgtt |
24031850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 24090493 - 24090432
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
24090493 |
taatacgctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgt |
24090432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 24815069 - 24815012
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgt |
24815012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 25600598 - 25600541
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
25600541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40066496 - 40066553
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||||| ||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt |
40066553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 3680802 - 3680746
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 4621354 - 4621298
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
4621298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 9496724 - 9496668
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 29992304 - 29992244
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
29992304 |
aataggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgt |
29992244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 31445464 - 31445412
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 38930665 - 38930609
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 1408354 - 1408299
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||| |||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt |
3680583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 14496815 - 14496870
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| |||||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 757 - 800
Target Start/End: Original strand, 24031911 - 24031954
Alignment:
| Q |
757 |
cttgttttaaaatacttatttttgatcgcgtacgacaacgatca |
800 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24031911 |
cttgttttaaaatacttatttttgatcgtgcacgacaacgatca |
24031954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 28323848 - 28323903
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttt |
75 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 6469677 - 6469611
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| |||||||||||||| |||| || || ||||||||| ||||||||||||||||||||| |
|
|
| T |
6469677 |
attattattaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgt |
6469611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 71
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttg |
71 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 14848186 - 14848137
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 20278059 - 20278005
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 21064686 - 21064632
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 21126023 - 21125965
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||| ||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
21126023 |
taggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt |
21125965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttag |
78 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||||||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 14488715 - 14488772
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgt |
14488772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||| ||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 27341253 - 27341310
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| || |||||| ||||||||| |
|
|
| T |
27341253 |
taataggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtcc |
27341310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 28497616 - 28497563
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
28497563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 42429757 - 42429813
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgt |
42429813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 10540447 - 10540503
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||| ||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
10540447 |
taggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 114
Target Start/End: Complemental strand, 13779531 - 13779447
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgtnnnnnnnntttgtttttagtccctgcaaa |
114 |
Q |
| |
|
|||||||||||| ||| ||||| |||||||| |||||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaatttttttttgtttttggtccctgcaaa |
13779447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 7578527 - 7578476
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||| ||| ||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc |
7578476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 23939542 - 23939597
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||| ||||||||||||||||| || || ||||||||||||||||| |||||||| |
|
|
| T |
23939542 |
taattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 27117977 - 27117922
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||| |||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 32195280 - 32195331
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtc |
32195331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 2356250 - 2356192
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||| |||| || | | ||||||||||||||||||||||||||| |||| |
|
|
| T |
2356250 |
taggttaaaatatgattttgattcatgcaaatatgtctcgttttggttttagtctctgt |
2356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 84
Target Start/End: Original strand, 4709931 - 4709961
Alignment:
| Q |
54 |
caaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4709931 |
caaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 9175373 - 9175315
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgt |
9175315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 25702510 - 25702568
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgt |
25702568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 36044718 - 36044676
Alignment:
| Q |
42 |
ttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
36044718 |
ttttaatccctgcaaatatatctcgttttggttttggtccctg |
36044676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 1778910 - 1778873
Alignment:
| Q |
48 |
tccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
1778910 |
tccctgcaaatatgtctcgttttggttttaatccctgt |
1778873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 4376012 - 4375960
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |
|
|
| T |
4376012 |
taggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 81
Target Start/End: Complemental strand, 23939907 - 23939858
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||| || ||| |||||||| |||||||||| |||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtcc |
23939858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 28497254 - 28497307
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| |||||||| |||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggtt |
74 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 55; Significance: 4e-22; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 3293 - 3235
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
3235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 1e-21; HSPs: 157)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 21124912 - 21124969
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
21124969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 33336037 - 33335970
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33336037 |
aattattaattggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
33335970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 36577719 - 36577778
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36577719 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 26133414 - 26133357
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
26133357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 24781985 - 24782045
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
24781985 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 26133183 - 26133239
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
26133239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 17 - 84
Target Start/End: Original strand, 5917114 - 5917181
Alignment:
| Q |
17 |
caattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| | |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5917114 |
caattaattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 17070866 - 17070807
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
17070866 |
ataggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgt |
17070807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 18046031 - 18046094
Alignment:
| Q |
22 |
attaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
18046031 |
attaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
18046094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 30800491 - 30800550
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30800491 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 1381237 - 1381303
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1381237 |
attaataaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
1381303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 4203772 - 4203714
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
4203714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 5950174 - 5950232
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
5950232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 10744056 - 10743998
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
10743998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 19685014 - 19685072
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19685014 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 29692742 - 29692800
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29692800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 30800852 - 30800794
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 40168014 - 40167952
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
40168014 |
ttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt |
40167952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 2217493 - 2217550
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2217550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 3850601 - 3850544
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 7075571 - 7075628
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
7075628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 28863509 - 28863566
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 29875727 - 29875670
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 36578084 - 36578027
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
36578027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 45138 - 45194
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
45194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 18633598 - 18633654
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 19565466 - 19565522
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 20690729 - 20690789
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
20690729 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
20690789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 28863838 - 28863782
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 29172887 - 29172831
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 29366949 - 29366893
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
29366893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 29875399 - 29875455
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 30888160 - 30888216
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
30888216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 35167166 - 35167110
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 35928458 - 35928402
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35928402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 38496783 - 38496727
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 40029497 - 40029441
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40029441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 23381947 - 23382006
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
23381947 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
23382006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 24443747 - 24443688
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24443747 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24443688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 3851331 - 3851273
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt |
3851273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 5614532 - 5614474
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
5614474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 6912855 - 6912801
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
6912801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 14318043 - 14318097
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 18046350 - 18046296
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 31037743 - 31037693
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31037743 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35877054 - 35876996
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgt |
35876996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 42207240 - 42207298
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt |
42207298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 1105150 - 1105093
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 4736543 - 4736486
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
4736486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 5614165 - 5614218
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 10743723 - 10743776
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 11799459 - 11799402
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt |
11799402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 16038376 - 16038429
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 18258528 - 18258475
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 19565833 - 19565776
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 19685381 - 19685324
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
19685324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 26071613 - 26071560
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgt |
26071560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 28108159 - 28108106
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgt |
28108106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 35166160 - 35166103
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| |||||||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 38170513 - 38170570
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
38170570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 38786158 - 38786215
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
38786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40029140 - 40029197
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgt |
40029197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40167785 - 40167842
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40167842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 1286682 - 1286738
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgt |
1286738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 1381612 - 1381556
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 5917461 - 5917405
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 10408927 - 10408983
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 15635708 - 15635652
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 35928063 - 35928119
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 37271707 - 37271651
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 24 - 84
Target Start/End: Original strand, 39379234 - 39379294
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39379234 |
taataggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 40764414 - 40764470
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 40764781 - 40764725
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 6118499 - 6118444
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 293822 - 293880
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
293822 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 1104856 - 1104914
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
1104914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 34125305 - 34125359
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 37271357 - 37271415
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgt |
37271415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 39379612 - 39379558
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 6953948 - 6954001
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||||| ||||||||| |
|
|
| T |
6953948 |
aggctaaaatatggttttaatcactacaaatatttcttgttttgattttagtcc |
6954001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 9179592 - 9179649
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt |
9179649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 9179921 - 9179864
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgt |
9179864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 10409328 - 10409275
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||| |||||||| |
|
|
| T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 13990896 - 13990843
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 413 - 532
Target Start/End: Original strand, 18810504 - 18810620
Alignment:
| Q |
413 |
aatataaattgatataggttatggcgcttagcatataacatttattgaactctgttatgatattgattgtgttcactgtgacgcttgtccactgtcatgg |
512 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||| || ||| ||||||| |||||||| ||| || |||| |||||||||||| ||||| ||||| |
|
|
| T |
18810504 |
aataaaaattgatacatgttatggcgcttagc---tagtattgcttgaactatgttatgacattaatcatgttatttgtgacgcttgttcactgccatgg |
18810600 |
T |
 |
| Q |
513 |
ttaattgaacacattctgat |
532 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18810601 |
ttaattgaacacattctgat |
18810620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 20660947 - 20661000
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 27916761 - 27916708
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgt |
27916708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 34125633 - 34125576
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
34125576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 11799128 - 11799184
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 12144903 - 12144963
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
12144903 |
aataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgt |
12144963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 15635379 - 15635431
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 18258161 - 18258217
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 20986090 - 20986034
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 21050575 - 21050631
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgt |
21050631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 21050913 - 21050857
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgt |
21050857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 24443379 - 24443435
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||| ||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 29151852 - 29151796
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 35876687 - 35876743
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 36973710 - 36973654
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgt |
36973654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 40038490 - 40038542
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
40038490 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 42553642 - 42553698
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgt |
42553698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 38554749 - 38554805
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
38554749 |
taggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtctctgt |
38554805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 5904006 - 5904064
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||| ||||||||||||| |
|
|
| T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgt |
5904064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 16038738 - 16038684
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgt |
16038684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 20416359 - 20416413
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 757 - 803
Target Start/End: Original strand, 22304601 - 22304647
Alignment:
| Q |
757 |
cttgttttaaaatacttatttttgatcgcgtacgacaacgatcaaaa |
803 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22304601 |
cttgttttaaaatacttatttttgatcgtccacgacaacgatcaaaa |
22304647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 25779164 - 25779106
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| || ||||||||||||| ||||| |
|
|
| T |
25779164 |
taggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt |
25779106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 32108806 - 32108864
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||| |||||| ||||||| |
|
|
| T |
32108806 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgt |
32108864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 78
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttag |
78 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 36278079 - 36278133
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| || |||| |||||||||| |
|
|
| T |
36278079 |
taggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 3850299 - 3850356
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttgg-ttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgt |
3850356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 81
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 17070534 - 17070590
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgt |
17070590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 20683746 - 20683803
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || || |||||||| |||||||| ||||||||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt |
20683803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 26071290 - 26071347
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt |
26071347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 28213372 - 28213425
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 28871995 - 28871938
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
28871938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 29693091 - 29693038
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 31602518 - 31602465
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||| |||||| | | |||||||||||||||||||| ||||||| |
|
|
| T |
31602518 |
ataggctaaaatatagttttagttcatacaaatatgtctcgttttgattttagt |
31602465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 42596452 - 42596509
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||| |||||||||||||| ||||| |
|
|
| T |
42596452 |
aggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgt |
42596509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
42596761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 20661311 - 20661255
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgt |
20661255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 35609303 - 35609359
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt |
35609359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 27916462 - 27916517
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| | ||| | ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgt |
27916517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 10830527 - 10830585
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || || |||||||| || |||||||||||||| ||||| |
|
|
| T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgt |
10830585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||| ||||||||||||||| | ||| ||||||||||| |||||||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||| | || || |||||||||||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 77
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 1287042 - 1286989
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt |
1286989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 81
Target Start/End: Complemental strand, 9588592 - 9588559
Alignment:
| Q |
48 |
tccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
9588592 |
tccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 590
Target Start/End: Original strand, 19009578 - 19009663
Alignment:
| Q |
505 |
tgtcatggttaattgaacacattctgatgattaatagaatggaatttgtataaaactaattatcgcttatttagttagttttataa |
590 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||| ||||||||| | |||||||||||| || || |||||||| || ||||| |
|
|
| T |
19009578 |
tgtcatggttaatctaacatattctgatgcttaatcaaatggaattcgcataaaactaattgacgattgtttagttaattctataa |
19009663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 6e-21; HSPs: 136)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 318101 - 318041
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
318101 |
aataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt |
318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 12419942 - 12419883
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12419942 |
aataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 25431856 - 25431798
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
25431798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 32885670 - 32885728
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32885670 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 10910969 - 10910908
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10910969 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10910908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 21993782 - 21993843
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21993782 |
taataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgt |
21993843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 26375692 - 26375749
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgt |
26375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 30928680 - 30928737
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
30928737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 1215006 - 1214942
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1215006 |
attattattaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 12419705 - 12419760
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12419705 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
23770217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 3969015 - 3968953
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3969015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3968953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 12176645 - 12176587
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
12176587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 6412216 - 6412273
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 7156162 - 7156105
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 8680769 - 8680830
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8680769 |
ttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 13150751 - 13150694
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgt |
13150694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 19690392 - 19690449
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
19690449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 21385245 - 21385306
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21385245 |
ttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 22543720 - 22543663
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 23502541 - 23502484
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgt |
23502484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 24692981 - 24692924
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 1007513 - 1007453
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1007513 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1007453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 3968644 - 3968700
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 10910629 - 10910685
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt |
10910685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 15076205 - 15076149
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 15962389 - 15962333
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
15962333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 24274132 - 24274076
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 33801744 - 33801688
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 34582529 - 34582585
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
34582585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 25137360 - 25137301
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25137360 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25137301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 317810 - 317868
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgt |
317868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 3414385 - 3414443
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3414443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 9896280 - 9896334
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgt |
9896334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 11448536 - 11448590
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 18024377 - 18024319
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
18024319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 22543351 - 22543409
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22543351 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 34582894 - 34582836
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt |
34582836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 1890454 - 1890397
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 3276355 - 3276302
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 7155791 - 7155852
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||||||||| |||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
7155791 |
ttaaaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 7324197 - 7324136
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
7324197 |
taataggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
7324136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 8170153 - 8170100
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 9896638 - 9896585
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 10091039 - 10091092
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
10091092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 12757609 - 12757666
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgt |
12757666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 14655377 - 14655434
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 14656261 - 14656204
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
14656204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 15962025 - 15962082
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 21994405 - 21994348
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 21995063 - 21995120
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt |
21995120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
26375989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 31198609 - 31198670
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31198609 |
ttaatgggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 494405 - 494457
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 2615870 - 2615926
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 3414753 - 3414697
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 8681117 - 8681061
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 19296407 - 19296351
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
19296351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 22822652 - 22822596
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 30929044 - 30928988
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30928988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 84
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
14428706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 20467722 - 20467663
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
20467722 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 21147401 - 21147460
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
21147401 |
ataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt |
21147460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 1007122 - 1007180
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
1007180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 12612361 - 12612303
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
12612361 |
taggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12612303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 13617531 - 13617585
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt |
13617585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 19129522 - 19129464
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgt |
19129464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 82
Target Start/End: Complemental strand, 22792900 - 22792846
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 25121181 - 25121234
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
25121181 |
ataggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 25121498 - 25121440
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt |
25121440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||| ||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 2373178 - 2373235
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||| |||||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt |
2373235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 3356141 - 3356194
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 6468309 - 6468366
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 11449170 - 11449113
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||| |||||||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt |
11449113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 12299141 - 12299084
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
12299084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25136993 - 25137050
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt |
25137050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 31398542 - 31398489
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 33131851 - 33131794
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt |
33131794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 33808614 - 33808675
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
33808614 |
ttaagaggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 34990312 - 34990259
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
34990259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 6412580 - 6412524
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 7323863 - 7323924
Alignment:
| Q |
28 |
aggctaaaatatggttttaat----ccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| |
|
|
| T |
7323863 |
aggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgt |
7323924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 19321133 - 19321081
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 21385585 - 21385529
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 21995425 - 21995369
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| |||||||||| |||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt |
21995369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 24273827 - 24273883
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 74
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtt |
74 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 13268108 - 13268163
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 1875500 - 1875558
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||| |||||||||| ||| |||||||| |
|
|
| T |
1875500 |
taggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgt |
1875558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 6564578 - 6564636
Alignment:
| Q |
26 |
ataggctaaaatatggttttaa-tccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6564578 |
ataggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 6564945 - 6564888
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
6564945 |
taggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
6564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 15722608 - 15722666
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||| ||||||||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt |
15722666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 19129333 - 19129391
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||| ||||||| ||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19129333 |
ataggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 19276041 - 19275983
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||||| |||||| ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19276041 |
taggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctgt |
19275983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 19320769 - 19320823
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgt |
19320823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 24901556 - 24901498
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgt |
24901498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 17765376 - 17765319
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgt |
17765319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 19296107 - 19296164
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| ||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt |
19296164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25431575 - 25431632
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| |||||||| ||||||| ||||| |
|
|
| T |
25431575 |
aggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgt |
25431632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 777676 - 777732
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| | ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 14655903 - 14655959
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt |
14655959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 31186591 - 31186535
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| | ||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt |
31186535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 1214695 - 1214750
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 76
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||| || || ||||||| ||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 23628799 - 23628854
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| | ||||||||||||||||| |||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgt |
23628854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 70
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgtttt |
70 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 30479421 - 30479366
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| | | | |||||||| ||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgt |
30479366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| ||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
31276284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 11926037 - 11925983
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| ||||||||||||||| |
|
|
| T |
11926037 |
aataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 15116662 - 15116721
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||| |||||||||||||||||||| || || |||||| |||||||||||||||||| |
|
|
| T |
15116662 |
aattatttttaggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 543726 - 543669
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| | |||||||||||| |||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 13617797 - 13617760
Alignment:
| Q |
48 |
tccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13617797 |
tccctgcaaatatgcctcgttttggttttagtccctgt |
13617760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
18024067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 19267913 - 19267856
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgt |
19267856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 51; Significance: 9e-20; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 35086 - 35028
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt |
35028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 9e-20; HSPs: 196)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 9289263 - 9289321
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9289263 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 13479613 - 13479555
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
13479555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 23245597 - 23245539
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgt |
23245539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 26412187 - 26412245
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26412187 |
ataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 23779226 - 23779169
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 46088062 - 46088005
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 52441759 - 52441819
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
52441759 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
52441819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 24474964 - 24474909
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 29380921 - 29380858
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||| |||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29380921 |
aatttttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 51738134 - 51738193
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51738134 |
ataggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgt |
51738193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 13631226 - 13631284
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13631284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 35464016 - 35464074
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35464074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 52430102 - 52430044
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
52430044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 2322433 - 2322376
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgt |
2322376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 8760603 - 8760660
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt |
8760660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 9289641 - 9289584
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 13064466 - 13064409
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13064409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 16712692 - 16712635
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16712635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 18136114 - 18136057
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18136114 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
18136057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 22099913 - 22099856
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
22099856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 22584282 - 22584343
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
22584282 |
taataggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgt |
22584343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25423923 - 25423980
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25423980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 25424313 - 25424256
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25424256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 26314333 - 26314276
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt |
26314276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 31182505 - 31182448
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgt |
31182448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 31811924 - 31811981
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt |
31811981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 32365484 - 32365427
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 34361802 - 34361855
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 35763645 - 35763702
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35763645 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 36701999 - 36702056
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
36702056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 47023107 - 47023050
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 49123322 - 49123265
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49123322 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
49123265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 52017504 - 52017561
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 52017871 - 52017814
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 52442093 - 52442036
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
52442036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 11693125 - 11693065
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
11693125 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
11693065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 13073759 - 13073815
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13073815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 14791807 - 14791751
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 29420539 - 29420483
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 34355287 - 34355227
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34355287 |
aataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt |
34355227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 41345852 - 41345908
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 43231087 - 43231143
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 46115780 - 46115724
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 46128914 - 46128858
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 53717174 - 53717118
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
53717118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 123530 - 123589
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
123530 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 8191076 - 8191131
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt |
8191131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 13530375 - 13530434
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
13530375 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 18205155 - 18205210
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 32208541 - 32208596
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 32208902 - 32208847
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 51545972 - 51545913
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
51545972 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
51545913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 53716918 - 53716973
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
53716918 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 53916051 - 53915992
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
53916051 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 4279020 - 4279078
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt |
4279078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 5797823 - 5797765
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5797823 |
ataggttaaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 8760791 - 8760725
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||| ||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
8760791 |
attaataaaaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt |
8760725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 12152495 - 12152437
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgt |
12152437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 13064157 - 13064215
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
13064215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 13764603 - 13764669
Alignment:
| Q |
19 |
attattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| || ||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
13764603 |
attatttatcggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt |
13764669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 14488189 - 14488131
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
14488131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18205467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 32365092 - 32365150
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 41346220 - 41346166
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 41619888 - 41619954
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||| | |||| ||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41619888 |
aattataagtaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
43368521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 45593226 - 45593284
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
45593226 |
taggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt |
45593284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 45593588 - 45593530
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||||||| ||||| |
|
|
| T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt |
45593530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 2034856 - 2034799
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt |
2034799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 2180219 - 2180276
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
2180276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 5827974 - 5827917
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt |
5827917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 13530714 - 13530657
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
13530657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 24774044 - 24774101
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24774101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 29463914 - 29463857
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgt |
29463857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 31812214 - 31812157
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
31812157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 38054549 - 38054602
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38054602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 42848026 - 42848083
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
42848083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 43231390 - 43231333
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
43231333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 45505599 - 45505656
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45505895 - 45505838
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 51708691 - 51708744
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 55072388 - 55072445
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
55072445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 5827655 - 5827711
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
5827711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 6827875 - 6827819
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 13631600 - 13631544
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 19321859 - 19321803
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
19321803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 19903257 - 19903317
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
19903257 |
aataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgt |
19903317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 26313988 - 26314044
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt |
26314044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 28809011 - 28809067
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt |
28809067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 29380667 - 29380723
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 29499181 - 29499237
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 30046793 - 30046737
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 30061134 - 30061078
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 31560330 - 31560386
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 31560695 - 31560639
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
31560639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 41324890 - 41324834
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt |
41324834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 46115414 - 46115470
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46115470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 46128548 - 46128604
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46128604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 53308068 - 53308012
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt |
53308012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt |
55482412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 2322094 - 2322149
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgt |
2322149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11285559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 18831181 - 18831122
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
18831181 |
atagactaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt |
18831122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 28809181 - 28809126
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt |
36050344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 55072715 - 55072656
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
55072715 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
55072656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 5882550 - 5882607
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
5882550 |
taggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgt |
5882607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 9445951 - 9446005
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
9446005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 12791976 - 12791918
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt |
12791918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 14487800 - 14487858
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt |
14487858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||| |||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 16712331 - 16712385
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||| |||||| |||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgt |
16712385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 30564835 - 30564889
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgt |
30564889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 35415296 - 35415354
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35415296 |
ataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 35763958 - 35763900
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||| ||||| ||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
35763958 |
ataggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 42823774 - 42823832
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgt |
42823832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 53915680 - 53915738
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
53915680 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 4211559 - 4211616
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 5052585 - 5052532
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||| |||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 41921085 - 41921032
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 46292652 - 46292595
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgt |
46292595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 51545628 - 51545685
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgt |
51545685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 54208822 - 54208769
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
54208769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 54903476 - 54903419
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
54903419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 8191391 - 8191335
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| ||||| ||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
8191335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 9446323 - 9446267
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgt |
9446267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 20291982 - 20292042
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
20291982 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgt |
20292042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 27427871 - 27427926
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 41620257 - 41620201
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 43368777 - 43368721
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||||| ||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgt |
43368721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 51709028 - 51708976
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
6353582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 77
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 12152151 - 12152210
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
12152151 |
ataggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt |
12152210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 85
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
27008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 28197278 - 28197227
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
28197278 |
taaaatatggttttagtctctacaaatatgtctcgtctttgttttagtccct |
28197227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 35119614 - 35119559
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||| ||||| |
|
|
| T |
35119614 |
ataggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| | ||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt |
36702307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 13074127 - 13074073
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 14594204 - 14594258
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
14594204 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 22584609 - 22584551
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||||| || || |||||||| |||||||||||||||||||||| |
|
|
| T |
22584609 |
taggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt |
22584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 30060766 - 30060824
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
30060766 |
ataggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 35420701 - 35420647
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgt |
35420647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||| |||||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 51830891 - 51830945
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||||| ||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgt |
51830945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 5797484 - 5797537
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgt |
5797537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 13764808 - 13764755
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 35119291 - 35119348
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt |
35119348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 36054151 - 36054094
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
36054094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45474597 - 45474540
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgt |
45474540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 50822295 - 50822238
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||| | ||| ||||||||||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgt |
50822238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 82
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 2180572 - 2180520
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||| | ||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| ||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 31370798 - 31370854
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||||||||||| | || | |||||| ||||||||||||||||| |
|
|
| T |
31370798 |
ttaataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 42824091 - 42824039
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 47532675 - 47532616
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||||| ||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
47532675 |
aataggctaaa-tatggttttggtccttgcaaatatgtctcgttttggttttagttcctgt |
47532616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
| Q |
34 |
aaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2034595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 37557194 - 37557139
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgt |
37557139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt |
44925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 27428204 - 27428146
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||| ||||||||||||| ||| |||||||||||| |||| ||||||||| |||| |
|
|
| T |
27428204 |
taggttaagatatggttttaatacctgcaaatatgtctcattttcgttttagtctctgt |
27428146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 37556839 - 37556897
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| |||| |||||||||||||||||| |
|
|
| T |
37556839 |
taggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt |
37556897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 50754258 - 50754200
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| || |||| || | |||||| ||||||||||||||| |
|
|
| T |
50754258 |
taggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgt |
50754200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 14791502 - 14791555
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
14791555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 19321568 - 19321625
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| |||| ||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 20144423 - 20144476
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||| ||||||| |||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgt |
20144476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 24474599 - 24474651
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
39 |
tggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 50753925 - 50753978
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||| |||||||||||||| ||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgt |
50753978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 51738413 - 51738356
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||| |||| ||||||| |
|
|
| T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 54903114 - 54903159
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
54903114 |
taaaatatggttttgatccctacaaatatgcatcgttttagtttta |
54903159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 9e-20; HSPs: 201)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 15979703 - 15979645
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
15979645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 4513621 - 4513564
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt |
4513564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 22008525 - 22008582
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22008582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 22016043 - 22016100
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22016100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 30130149 - 30130214
Alignment:
| Q |
20 |
ttattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
30130149 |
ttatttataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
30130214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 39288900 - 39288843
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39288900 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 39436717 - 39436773
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 40169343 - 40169399
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 50196661 - 50196601
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
50196661 |
aataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt |
50196601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
53701607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 28427241 - 28427300
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28427241 |
aataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 47336584 - 47336525
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47336584 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
47336525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 54608866 - 54608807
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54608866 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
54608807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt |
31869650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 31869958 - 31869900
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
31869900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 34238596 - 34238650
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 37506864 - 37506922
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37506864 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 51550448 - 51550390
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
51550390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 3152113 - 3152056
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3152113 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 4513262 - 4513319
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4513319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 4950036 - 4950093
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4950093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 9603626 - 9603683
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9603626 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 12740905 - 12740962
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 12741272 - 12741215
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
12741215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 22155927 - 22155984
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 40979711 - 40979654
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgt |
40979654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 46751270 - 46751323
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 474043 - 474099
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 3151748 - 3151804
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 4034717 - 4034773
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4034773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 10977342 - 10977286
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 20612899 - 20612843
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 25710870 - 25710814
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
25710814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 26090078 - 26090022
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
26090022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 28427609 - 28427553
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 30034476 - 30034416
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
30034476 |
aataggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgt |
30034416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 35407794 - 35407734
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
35407794 |
aataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt |
35407734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 37507223 - 37507167
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 39288572 - 39288624
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 39437110 - 39437054
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 43441604 - 43441548
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 51834607 - 51834663
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 25710503 - 25710566
Alignment:
| Q |
22 |
attaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
25710503 |
attattaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25710566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 29446209 - 29446154
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
29446209 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 29490754 - 29490687
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| ||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
29490754 |
aatttttactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
29490687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 474411 - 474353
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
474411 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 3830132 - 3830190
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
3830190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 3830518 - 3830464
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3830518 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 21159819 - 21159761
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
21159761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50196355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 5345690 - 5345633
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
5345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 15016379 - 15016444
Alignment:
| Q |
20 |
ttattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| || |||||||||||||||||| ||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
15016379 |
ttatttattggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 21159452 - 21159505
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25615974 - 25616031
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25616031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 26799882 - 26799943
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26799882 |
ttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28452378 - 28452321
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28552385 - 28552328
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 29525104 - 29525157
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 30268504 - 30268561
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30268561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 31480135 - 31480192
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
31480192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 35569133 - 35569080
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35569080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 45002015 - 45002076
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
45002015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45320980 - 45320923
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45320923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 47005153 - 47005210
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgt |
47005210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 51550080 - 51550137
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 51759818 - 51759875
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| || | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgt |
51759875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 51834944 - 51834887
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 9262158 - 9262102
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9262158 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
9863348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 13584368 - 13584312
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 14633890 - 14633834
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 16123139 - 16123195
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
16123195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 20907461 - 20907401
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
20907461 |
aataggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 28942906 - 28942850
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 29445954 - 29446010
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29446010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 30552479 - 30552423
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| |||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 49323782 - 49323838
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
49323838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 54608517 - 54608573
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 4814899 - 4814845
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 12673633 - 12673700
Alignment:
| Q |
18 |
aattattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| ||| |||||||||||| |||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12673633 |
aattaataaaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
12673700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 30106223 - 30106164
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
30106223 |
ataggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
30106164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 35498413 - 35498472
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35498413 |
ataggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgt |
35498472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 43440494 - 43440549
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 275441 - 275499
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||| ||||||||| |||||||||||| |
|
|
| T |
275441 |
ataggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 28552019 - 28552077
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgt |
28552077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
29955354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 29955668 - 29955610
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
29955610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
30004508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 30004823 - 30004765
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
30004765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 30128282 - 30128340
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt |
30128340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 40545562 - 40545620
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
40545620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 49324149 - 49324091
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49324149 |
ataggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 1721453 - 1721396
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
1721396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
35 |
aatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 9597096 - 9597039
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgt |
9597039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Original strand, 14633547 - 14633600
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 19844582 - 19844525
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
19844525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 28942522 - 28942575
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| || |||||||||||||| |
|
|
| T |
28942522 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Original strand, 32119218 - 32119275
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 35565507 - 35565564
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgt |
35565564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45002386 - 45002329
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgt |
45002329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 45161116 - 45161169
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgt |
45161169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 46186772 - 46186715
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||| |||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgt |
46186715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 46622131 - 46622074
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 46901101 - 46901154
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||||||||||||||| |
|
|
| T |
46901101 |
ataggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 48924241 - 48924184
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
48924184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt |
54767471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 4035061 - 4034997
Alignment:
| Q |
21 |
tattaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||||||| ||||| |
|
|
| T |
4035061 |
tattaattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt |
4034997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 9261789 - 9261845
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
9261845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 19844265 - 19844321
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgt |
19844321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 20611019 - 20611071
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 30424628 - 30424684
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| ||||| ||||||||| |||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgt |
30424684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 32119585 - 32119529
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 44802282 - 44802338
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgt |
44802338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 47336227 - 47336283
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt |
11463288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 34238922 - 34238863
Alignment:
| Q |
22 |
attaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
34238922 |
attaaaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 1721087 - 1721145
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||| |||||||||||||| ||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt |
1721145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 4321944 - 4322002
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| | |||| | |||||||||||| ||||||||||| ||||||| |
|
|
| T |
4321944 |
taggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgt |
4322002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 13514579 - 13514525
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||| |||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 14772210 - 14772264
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 20757777 - 20757719
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
20757777 |
taggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgt |
20757719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 79
Target Start/End: Complemental strand, 21971046 - 21971000
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21971000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 79
Target Start/End: Complemental strand, 21993482 - 21993436
Alignment:
| Q |
33 |
aaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21993436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 25609765 - 25609823
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| || |||||||| | ||||||||||||||||||||||| |
|
|
| T |
25609765 |
taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgt |
25609823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 28452145 - 28452199
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||| |||||||||||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 45006247 - 45006193
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
45006193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 47005521 - 47005467
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 863649 - 863596
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgt |
863596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 3387605 - 3387552
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 4322186 - 4322133
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
4322133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 7518089 - 7518142
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||| |||||||| |||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 8940163 - 8940216
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgt |
8940216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 18175791 - 18175845
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgt |
18175845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 19656540 - 19656593
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||| ||||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 21553888 - 21553945
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| ||||||| |||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgt |
21553945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 29686543 - 29686600
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||| ||||||||||| ||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgt |
29686600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 38232240 - 38232293
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt |
40545783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggt |
73 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 52342584 - 52342531
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 7957226 - 7957170
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt |
7957170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 9863045 - 9863100
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 20644505 - 20644561
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt |
20644561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 39072213 - 39072157
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| ||||||||| ||||| ||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgt |
39072157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 40370285 - 40370341
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgt |
40370341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 45313863 - 45313807
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgt |
45313807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccc-tacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 50261936 - 50261880
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||| || |||||||||||||| |||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgt |
50261880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 51500393 - 51500449
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||||||||||| || || || ||||||| |||||||||||||||||| |
|
|
| T |
51500393 |
taataggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttag |
78 |
Q |
| |
|
|||||||||||||| || ||||| |||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 53113442 - 53113490
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggtttt |
76 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 53701361 - 53701417
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| || |||||||| || |||| |||||||||||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgt |
53701417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| || || |||||||| |||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt |
9596814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 77
Target Start/End: Complemental strand, 9603922 - 9603871
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
| T |
9603922 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 27200441 - 27200488
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |||| |||||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagttttagt |
27200488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 27681685 - 27681626
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| | || || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
27681685 |
ataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgt |
27681626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 28418899 - 28418844
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| | |||||| ||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt |
28418844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 35533618 - 35533567
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
|||||||||||| |||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
35533618 |
ggctaaaatatgattttgctccctacacatatgtctcgttttgattttagtc |
35533567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 36672960 - 36673019
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||| |||||||||||||| || || ||||||||||| ||||||||||||||| |||| |
|
|
| T |
36672960 |
ataggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgt |
36673019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 46724901 - 46724846
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||| | |||||| ||||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgt |
46724846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 863279 - 863337
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| |||| ||| | ||||||||||||||||| ||||||||| |||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgt |
863337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 7588316 - 7588374
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| || ||||||||||||||| |||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgt |
7588374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 84
Target Start/End: Original strand, 20644578 - 20644620
Alignment:
| Q |
42 |
ttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
20644578 |
ttttgatccctgcaaatatgtctcgttttggttttggtccctg |
20644620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 55 - 85
Target Start/End: Original strand, 20907163 - 20907193
Alignment:
| Q |
55 |
aaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20907163 |
aaatatgtctcgttttggttttagtccctgt |
20907193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 35936779 - 35936833
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 39132908 - 39132850
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| || | ||||||| ||||||||| |
|
|
| T |
39132908 |
taggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgt |
39132850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 46724545 - 46724599
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| |||| |||| | ||||||| ||||||||| |||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgt |
46724599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 52342193 - 52342243
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
| T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 52956383 - 52956433
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
52956383 |
ggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
39 |
tggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 29678023 - 29678080
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| ||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
29678080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 30130505 - 30130452
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||| ||||||||||||| || || |||||||| ||| ||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccc |
82 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||| ||||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagt-cctgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40277821 - 40277878
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgt |
40277878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 45521833 - 45521780
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||| || | ||||||||| |||||||||||||||| ||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
45521780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 53632506 - 53632555
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||| |||||||||| |
|
|
| T |
53632506 |
taaaatatggttttagtccctataaatatggttcgttttagttttagtcc |
53632555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 50; Significance: 3e-19; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 4289 - 4236
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 19471 - 19418
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 4039 - 4093
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 19221 - 19275
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 49; Significance: 1e-18; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 1310 - 1366
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 1645 - 1589
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 49; Significance: 1e-18; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 290 - 234
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 49; Significance: 1e-18; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 24368 - 24428
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
24368 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 48; Significance: 5e-18; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 94054 - 94113
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
94054 |
ataggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgt |
94113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggtttta |
77 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 14695 - 14753
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 15013 - 14956
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
14956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 27366 - 27308
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27366 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
27308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 75357 - 75415
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgt |
75415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 75766 - 75709
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
75766 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 46; Significance: 9e-17; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 2777 - 2834
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 46; Significance: 9e-17; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 366274 - 366217
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
366217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 365979 - 366035
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt |
366035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 9028 - 8972
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 8734 - 8788
Alignment:
| Q |
31 |
ctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 3919 - 3862
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
3862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 5709 - 5653
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 5398 - 5450
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 82710 - 82650
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
82710 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
82650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 82340 - 82396
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 45; Significance: 3e-16; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 47924 - 47980
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 223174 - 223120
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
223174 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 48228 - 48175
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
48175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 148282 - 148226
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
148226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 17651 - 17706
Alignment:
| Q |
30 |
gctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt |
17706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 17966 - 17910
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| ||||| ||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
17910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 10518 - 10459
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
10518 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
10459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 8648 - 8590
Alignment:
| Q |
23 |
ttaataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8648 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 8329 - 8382
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 5208 - 5265
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 5228 - 5285
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 54814 - 54871
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
54871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
32 |
taaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 8546 - 8602
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
36 |
atatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 12182 - 12238
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 2496 - 2555
Alignment:
| Q |
24 |
taataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
2496 |
taataggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 18045 - 17987
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||| |||||||||| |||||||||||| |
|
|
| T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt |
17987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 2662 - 2606
Alignment:
| Q |
27 |
taggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccct |
83 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || |||||||||||||||||| |
|
|
| T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 16724 - 16780
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt |
16780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
29 |
ggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
||||||||||| |||||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 4082 - 4028
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtc |
80 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
4082 |
ataggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 3748 - 3808
Alignment:
| Q |
25 |
aataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtccctgt |
85 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| | |||||||||||| ||||||| |
|
|
| T |
3748 |
aataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgt |
3808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 34; Significance: 0.000000001; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 22056 - 22003
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagtcc |
81 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| || ||||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 73
Target Start/End: Original strand, 21695 - 21739
Alignment:
| Q |
28 |
aggctaaaatatggttttaatccctacaaatatgtctcgttttggt |
73 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatatgt-tcgttttggt |
21739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 189326 - 189379
Alignment:
| Q |
26 |
ataggctaaaatatggttttaatccctacaaatatgtctcgttttggttttagt |
79 |
Q |
| |
|
|||||||||||||| ||||| || ||| ||||||| ||||||||||||||||| |
|
|
| T |
189326 |
ataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University