View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_33 (Length: 344)
Name: NF12929_high_33
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 40892410 - 40892339
Alignment:
| Q |
17 |
atcatgattgatccaagtcaattgaatcaaatatttgaattatgcactcatacattgccttctttaaagccg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892410 |
atcatgattgatccaagtcaattgaatcaaatatttgaattatgcactcatacattgccttctttaaagccg |
40892339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 277 - 333
Target Start/End: Original strand, 40886378 - 40886434
Alignment:
| Q |
277 |
taaggcctaacatcagtcctaaacatcaacccatccctcctactcgtcctgatgatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40886378 |
taaggcctaacatcagtcctaaacatcaacccatccatcctactcgtcctgatgatg |
40886434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 39 - 88
Target Start/End: Complemental strand, 44143828 - 44143779
Alignment:
| Q |
39 |
tgaatcaaatatttgaattatgcactcatacattgccttctttaaagccg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143828 |
tgaatcaaatatttgaattatgcactcatacattgccttctttaaagccg |
44143779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 40892251 - 40892209
Alignment:
| Q |
176 |
tggcaatgataaactacactccacttagtgagctacttcaatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892251 |
tggcaatgataaactacactccacttagtgagctacttcaatg |
40892209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 44143694 - 44143652
Alignment:
| Q |
176 |
tggcaatgataaactacactccacttagtgagctacttcaatg |
218 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
44143694 |
tggcaatgataaaccatactccacttagtgagctacttcaatg |
44143652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University