View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_36 (Length: 325)
Name: NF12929_high_36
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 33111137 - 33111213
Alignment:
| Q |
39 |
atagactaaagaaggatattaaagaaaagtgactcatattctccatatcctgagattttgagtgaaaatatcgtgtt |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
33111137 |
atagactaaagaaggattttaaagaaaagtgacttgcattctccatattttgagattttgagtgaagatatcatgtt |
33111213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 268 - 302
Target Start/End: Original strand, 33111400 - 33111434
Alignment:
| Q |
268 |
ttccaaaatgctgtttttagtgttttcttacaaaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33111400 |
ttccaaaatgctgtttttagtgttttcttacaaaa |
33111434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 33111211 - 33111268
Alignment:
| Q |
142 |
gttagtatcccttaagactataatgattagttcgttgtattttatcgatgcttcatcg |
199 |
Q |
| |
|
||||| ||||||| ||||||| || ||||| ||||||| |||||| |||||||||||| |
|
|
| T |
33111211 |
gttagcatcccttgagactatgataattagctcgttgttttttattgatgcttcatcg |
33111268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 33111325 - 33111370
Alignment:
| Q |
220 |
tagaaaagtttaaaaatacaaataaaacc-aaacaatgccctttcc |
264 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
33111325 |
tagaaaagtttataaatacaaataaaaccaaaacaatgccttttcc |
33111370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University