View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_40 (Length: 299)
Name: NF12929_high_40
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_40 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 299
Target Start/End: Original strand, 388627 - 388921
Alignment:
| Q |
5 |
atgaatatgattttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtgttcgaatcg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
388627 |
atgaatatgattttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtattcgaatcg |
388726 |
T |
 |
| Q |
105 |
agtttaccggttacttggagtccaagatttctttggtatttgatgatagctgattcaaaattcgaatcaaatttgtcgctgaatgtgtcattgtttttaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388727 |
agtttaccggttacttggagtccaagatttctttggtatttgatgatagctgattcaaaattcgaatcaaatttgtcgctgaatgtgtcattgtttttaa |
388826 |
T |
 |
| Q |
205 |
tgtacccgaaacgagataggtatcttttgaactgtgatattcctgtgatgttgttgcctctgacagaattggtgaagctatgaatgtcatgattt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
388827 |
tgtacccgaaacgagataggtatcttttgaactgtgatattcctgtgatgttgttgcctctgacagcattggtgaagctatgaatgtcatgattt |
388921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University