View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_high_41 (Length: 294)
Name: NF12929_high_41
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 3762301 - 3762184
Alignment:
| Q |
104 |
gaaaaccaacatcagaattgaaaatgtatttgtgttttatatactttatgagttttatgtataggattaannnnnnnnnnaaggaatgtataggactaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
3762301 |
gaaaaccaacatcagaattgaaaatgtatttgtgttttttatactttatgagttttatgtataggattaaaaaaaaatttaaggaatgtataggattaat |
3762202 |
T |
 |
| Q |
204 |
taaattgatcatgaactt |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3762201 |
taaattgatcatgaactt |
3762184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University