View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_low_29 (Length: 356)
Name: NF12929_low_29
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 42968426 - 42968102
Alignment:
| Q |
1 |
attagcagatatgctcaatcatccatgcttgggttgggtgggtgctccatggattgtgaca-----attcactagttccacagtgtatggtattggacat |
95 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42968426 |
attagcagatatgctcaaccatccatgcttgggttgggtgggtgctccatggattgtgacatgacaattcactagttccacagtgtatggtattggacat |
42968327 |
T |
 |
| Q |
96 |
aaaactgaatgtctcaaggcctttgtttctttccagcatcatcagcttcctagtggtagtagtttggctgcttttttgtacaaagcttaattttgcttta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42968326 |
aaaactgaatgtctcaaggcctttgtttctttccagcatcatcagcttcctagtagtagtagtttggctgcttttttgtacaaaacttaattttgcttta |
42968227 |
T |
 |
| Q |
196 |
tctcaaatatcatattcatagcagacaattgctttattttgccttttctcatttctgtatgttttttctaatttaatttaaatacataaagtaggttgaa |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968226 |
tctcaaatatcatattcatagcagacaattgctttattttgccttatctcatttctgtatgttttttctaatttaatttaaatacataaagtaggttgaa |
42968127 |
T |
 |
| Q |
296 |
ttatgcaatggaattaggattatca |
320 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
42968126 |
ttatgcaatgggattaggattatca |
42968102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University