View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_low_35 (Length: 335)
Name: NF12929_low_35
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 90 - 312
Target Start/End: Complemental strand, 3525135 - 3524912
Alignment:
| Q |
90 |
tatcaaatatctctctctgtatgcattaaacaaaatcattgtttatcgttgtnnnnnnntatattgaagtttatattttatattaaattctttaaagtaa |
189 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3525135 |
tatcaaatatatctctctatatgcattaaacaaaatcattgtttatcgttgtaaaaaaatatattgaagtttatattttatattaaattctttaaagtaa |
3525036 |
T |
 |
| Q |
190 |
gactcaaagttaaatacatctagggctccttatgcaagtatgctaacgttagatcccaaccacacat-attttttaaaatataaaatgttagggattatt |
288 |
Q |
| |
|
|| ||||||||||||||| |||||| | ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||| |
|
|
| T |
3525035 |
gaatcaaagttaaatacaactagggtttcttatgcaattatgctaacgttagatcccaaccacacatgattttttaaaatataaaatgttagagcttatt |
3524936 |
T |
 |
| Q |
289 |
taaaagtttatttagctaaacata |
312 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3524935 |
taaaagtttatttagctaaacata |
3524912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University