View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12929_low_40 (Length: 300)

Name: NF12929_low_40
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12929_low_40
NF12929_low_40
[»] chr3 (1 HSPs)
chr3 (227-286)||(44093144-44093203)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 286
Target Start/End: Complemental strand, 44093203 - 44093144
Alignment:
227 agtatgcatgacaaaacaattgcattcattgggtagacaacagtttcaatctatgatgtg 286  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
44093203 agtatgcatgacaaaacaattgcattcgttgggtagacaacagtttcaatctatgatgtg 44093144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University