View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12929_low_42 (Length: 294)

Name: NF12929_low_42
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12929_low_42
NF12929_low_42
[»] chr8 (1 HSPs)
chr8 (104-221)||(3762184-3762301)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 3762301 - 3762184
Alignment:
104 gaaaaccaacatcagaattgaaaatgtatttgtgttttatatactttatgagttttatgtataggattaannnnnnnnnnaaggaatgtataggactaat 203  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||          ||||||||||||||| ||||    
3762301 gaaaaccaacatcagaattgaaaatgtatttgtgttttttatactttatgagttttatgtataggattaaaaaaaaatttaaggaatgtataggattaat 3762202  T
204 taaattgatcatgaactt 221  Q
    ||||||||||||||||||    
3762201 taaattgatcatgaactt 3762184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University