View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_low_47 (Length: 250)
Name: NF12929_low_47
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_low_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 44093669 - 44093424
Alignment:
| Q |
10 |
attattctagaatgaaaattatgtgttagattacatgggatgannnnnnnagcaccaagttggttgccattttatatgttgcttttatcctgggtgtatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093669 |
attattctagaatgaaaattatgtgttagattacatgggatgatttttttagcaccaagttggttgccattttatatgttgcttttatcctgggtgtatg |
44093570 |
T |
 |
| Q |
110 |
tatctcctgattctgaagtctttttacaaatttggtgtctgatcaacatttctcttctgcag-----tttgtaattatgccaatggacaatggtagatta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44093569 |
tatctcctgattctgaagtctttttacaaatttggtgtctgatcaacatttctcttctgcagtttaatttgtaattatgccaatggacaatggtagatta |
44093470 |
T |
 |
| Q |
205 |
actactgcggacaaaaagagaccatgtattctgggtttggttgtaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44093469 |
actactgcggacaaaaagagaccatgtattctgggtttggctgtaa |
44093424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University