View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_low_48 (Length: 250)
Name: NF12929_low_48
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_low_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 78 - 250
Target Start/End: Original strand, 32939931 - 32940108
Alignment:
| Q |
78 |
aaggtgttggtctagatgaaggaactagacttcaacaacgtgtgacgaacaaaaattcaaatatcgactgnnnnnnnng-----tacccacttttataat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32939931 |
aaggtgttggtctagatgaaggaactagacttcaacaacgtgtgatgaactaaaattcaaatatcgactggaaaaaaaaaaaaatacccacttttataat |
32940030 |
T |
|
| Q |
173 |
gtcttgattgacttatgtgaagggaactaaaccaaagaaacttaaaatatacagttaattttacaattaatcaactcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32940031 |
gtcttgattgacttatgtgaagggaactaaaccaaagaaaattaaaatatacagttaattttacaattaatcaactcc |
32940108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University