View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12929_low_69 (Length: 203)
Name: NF12929_low_69
Description: NF12929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12929_low_69 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 203
Target Start/End: Original strand, 52584252 - 52584453
Alignment:
| Q |
2 |
gttagattctccaccacaggttgattacaaggctcacgtgtctgatcttgaccaggcatgaagtaacttggattgatcataagaccttgatttaaggaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584252 |
gttagattctccaccacaggttgattacaaggctcacgtgtctgatcttgaccaggcatgaagtaacttggattgatcataagaccttgatttaaggaac |
52584351 |
T |
 |
| Q |
102 |
ggtttctgtattcatcaacaagcatgtgagagcctaaagaaagggataggccttgttgtgtctggtgattattctcggttgctgcaccaagtagatccat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52584352 |
ggtttctgtattcatcaacaagcatgtgagagcctaaagaaagggataggccttgttgtgtctggtgattattctcgtttgctgcaccaagtagatccat |
52584451 |
T |
 |
| Q |
202 |
ca |
203 |
Q |
| |
|
|| |
|
|
| T |
52584452 |
ca |
52584453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University