View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_high_20 (Length: 279)
Name: NF1292_high_20
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 58 - 235
Target Start/End: Original strand, 41063532 - 41063709
Alignment:
| Q |
58 |
attgctggcactgatttacaggtgctgaagcgtggcgatgattcaatagatattatcagtcttgagcaggaatcaaaagatgattcagaagataatatcc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063532 |
attgctggcactgatttacaggtgctgaagcgtggcgatgattcaatagatattatcagtcttgagcaggaatcaaaagatgattcagaagataatatcc |
41063631 |
T |
 |
| Q |
158 |
taaaggaaatactggaggctatgaaagctgaactctgaaacgcatagcggccatacttagctaaaatcctttcacgtc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41063632 |
taaaggaaatactggaggctatgaaagctgaactctgaaacgcatagtggccatacttagctaaaatcctttcacgtc |
41063709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University