View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_high_29 (Length: 213)
Name: NF1292_high_29
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 5998945 - 5999073
Alignment:
| Q |
1 |
agatgcggccatgttacgagctatctattgacattggcattgctggtctttgcattcattgttatgtcgttccagaattcaaagggcaccgtgggatgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998945 |
agatgcggccatgttacgagctatctattgacattggcattgctggtctttgcgttcattgttatgtcgttccagaattcaaagggcaccgtgggatgac |
5999044 |
T |
 |
| Q |
101 |
ataccattgttattcatgtggtgatgatg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5999045 |
ataccattgttattcatgtggtgatgatg |
5999073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University