View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1292_high_4 (Length: 577)

Name: NF1292_high_4
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1292_high_4
NF1292_high_4
[»] chr8 (2 HSPs)
chr8 (74-290)||(31928538-31928748)
chr8 (487-564)||(31928319-31928398)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 4e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 74 - 290
Target Start/End: Complemental strand, 31928748 - 31928538
Alignment:
74 aatgtgaacaaattcaactgaccaatattctgtaaccaacggttattgagagaacatgcaaagggggatataactagcactaaagattaacggttccaag 173  Q
    ||||||||||||||| |||||||||||       ||||||||||||||||| ||||||||| |||  |||||||||||||||| ||||||||||||||||    
31928748 aatgtgaacaaattccactgaccaata-------accaacggttattgagataacatgcaatgggatatataactagcactaaggattaacggttccaag 31928656  T
174 caaa-tttgcaacaataacaaaagttgcagctcaaaagtggacccagtatagcaaaacaaccgatgatattgtatattgtaatggaaattttcgacttta 272  Q
    |||| ||||||| ||||||||||||||||| |||||||| ||||||||||||||||  |||| ||||||||||| |||||||||||||||| | ||||||    
31928655 caaaatttgcaataataacaaaagttgcagttcaaaagtagacccagtatagcaaaggaaccaatgatattgtaaattgtaatggaaatttccaacttta 31928556  T
273 attgattattcctttttt 290  Q
    |||||| |||||||||||    
31928555 attgataattcctttttt 31928538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 487 - 564
Target Start/End: Complemental strand, 31928398 - 31928319
Alignment:
487 tatttaggtattttgggttaga--gttaatgaattaaggtttagccataagtctcctttttatggggaattattagggtt 564  Q
    ||||||||||||||||| ||||  || |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
31928398 tatttaggtattttggggtagaaagtgaatgaattaaggtttagccataagtctcctttttatggggaagtattagggtt 31928319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University