View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_11 (Length: 499)
Name: NF1292_low_11
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 220 - 404
Target Start/End: Complemental strand, 54984411 - 54984227
Alignment:
| Q |
220 |
tttcaagaaattctgataagcatttgattaaattttgcattgatcaattggtcttccgtagggagaaatctttggatacaaaatagcataatctttcaca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984411 |
tttcaagaaattctgataagcatttgattaaattttgcattgatcaattggtcttccgtaaggagaaatctttggatacaaaatagcataatctttcaca |
54984312 |
T |
|
| Q |
320 |
gttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcgacatgtcataa |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984311 |
gttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcgacatgtcataa |
54984227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 85 - 158
Target Start/End: Complemental strand, 54984546 - 54984473
Alignment:
| Q |
85 |
agagaaaattcaaacaccatacaacataaacaccaataaaaacacgactcaacaaaaggtaccaccaacacgaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984546 |
agagaaaattcaaacaccatacaacataaacaccaataaaaacacgactcaacaaaaggtaccaccaacacgaa |
54984473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 9e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 303 - 393
Target Start/End: Original strand, 31320337 - 31320427
Alignment:
| Q |
303 |
tagcataatctttcacagttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcg |
393 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||||||||| ||||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
31320337 |
tagcataatcttttactggtttgtataatactggccttgactcgttcactagtttgtcaatcggttgaatctctttctctgaatttgggcg |
31320427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 393
Target Start/End: Original strand, 31326377 - 31326463
Alignment:
| Q |
307 |
ataatctttcacagttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcg |
393 |
Q |
| |
|
||||||||| || | | ||||| ||| |||||||||||| ||||||||||||||||| |||| | ||||||||| |||| |||||| |
|
|
| T |
31326377 |
ataatcttttactggtctgtatgataatggccttgactcgttcactagtttgtcaatcggttgaatctctttctccgaatctgggcg |
31326463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University