View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_22 (Length: 399)
Name: NF1292_low_22
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 29 - 245
Target Start/End: Original strand, 39298955 - 39299171
Alignment:
| Q |
29 |
aaatcacccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgcca |
128 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298955 |
aaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgcca |
39299054 |
T |
|
| Q |
129 |
caggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaagagttgcatctttggc |
228 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39299055 |
caggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaacagttgcatctttggc |
39299154 |
T |
|
| Q |
229 |
ttgtgctgctttctcca |
245 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39299155 |
ttgtgctgctttctcca |
39299171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University