View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1292_low_28 (Length: 339)

Name: NF1292_low_28
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1292_low_28
NF1292_low_28
[»] chr3 (1 HSPs)
chr3 (174-330)||(40548956-40549113)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 174 - 330
Target Start/End: Complemental strand, 40549113 - 40548956
Alignment:
174 catttataccaaaatttatgtaccaaaaaatatgcaccactttttatgtaaagttgcatgtttcgttctattctaacatctgtactacatacggtacaat 273  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40549113 catttataccaaaatttatgtaccaaaaaatatgcaccactttttatgtaaagttgcatgtttcgttctattctaacatctgtactacatacggtacaat 40549014  T
274 cgattgatgatgt-ccatctcattgcattaccaattgtttatcagtacatatattctt 330  Q
    ||||||| |||||  ||  | |||||||||| ||||||||||||||||||||||||||    
40549013 cgattgaggatgtgacaaattattgcattacaaattgtttatcagtacatatattctt 40548956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University